Human UPK2(Uroplakin 2) ELISA Kit

Human UPK2(Uroplakin 2) ELISA Kit

Human Uroplakin 2 (UPK2) ELISA Kit

SEF561Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit

SEF561Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit

SEF561Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit

SEF561Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit

4-SEF561Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Uroplakin 2 elisa. Alternative names of the recognized antigen: UPII
  • Uroplakin II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uroplakin 2 (UPK2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Bovine Uroplakin- 2, UPK2 ELISA KIT

ELI-28839b 96 Tests
EUR 928

Porcine Uroplakin- 2, UPK2 ELISA KIT

ELI-39864p 96 Tests
EUR 928

Mouse Uroplakin- 2, Upk2 ELISA KIT

ELI-36741m 96 Tests
EUR 865

Mouse Uroplakin-2 (Upk2)

1-CSB-EP025656MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Uroplakin-2(Upk2) expressed in E.coli

Uroplakin 2 (UPK2) Antibody

20-abx116547
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroplakin-2 (UPK2) Antibody

20-abx126762
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroplakin 2 (UPK2) Antibody

20-abx131673
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uroplakin-2 (UPK2) Protein

20-abx261408
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Uroplakin-2 (UPK2) Antibody

abx239274-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Uroplakin-2 (UPK2) Antibody

20-abx002383
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Recombinant Uroplakin 2 (UPK2)

4-RPF561Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O00526
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Uroplakin 2 expressed in: E.coli

ELISA kit for Human UPK2 (Uroplakin 2)

ELK5223 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroplakin 2 (UPK2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uroplakin 2 (UP
  • Show more
Description: A sandwich ELISA kit for detection of Uroplakin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Uroplakin 2 (UPK2) CLIA Kit

20-abx494951
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Uroplakin 2 (UPK2) Protein

20-abx650668
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uroplakin 2 (UPK2) Antibody (Cy3)

20-abx274287
  • EUR 592.00
  • EUR 286.00
  • EUR 1887.00
  • EUR 857.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human)

4-PAF561Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2)

UPK2 Uroplakin 2 Human Recombinant Protein

PROTO00526 Regular: 20ug
EUR 317
Description: UPK2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 153 amino acids (26-155 a.a) and having a molecular mass of 16.2kDa.;UPK2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Human Uroplakin-2/UPK2 (C-6His)

CA11-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)

CA11-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)

CA11-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)

CA11-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), APC

4-PAF561Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with APC.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), Biotinylated

4-PAF561Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with Biotin.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), Cy3

4-PAF561Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with Cy3.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), FITC

4-PAF561Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with FITC.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), HRP

4-PAF561Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with HRP.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), PE

4-PAF561Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with PE.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), APC-Cy7

4-PAF561Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with APC-Cy7.

UPK2 ELISA KIT|Human

EF004088 96 Tests
EUR 689

UPK2 ELISA Kit (Human) (OKAN06386)

OKAN06386 96 Wells
EUR 792
Description: Description of target: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.053 ng/mL

UPK2 ELISA Kit (Human) (OKCD00470)

OKCD00470 96 Wells
EUR 831
Description: Description of target: Component of the asymmetric unit membrane (AUM); a highly specialized biomembrane elaborated by terminally differentiated urothelial cells. May play an important role in regulating the assembly of the AUM (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human Uroplakin-2 (UP2) Antibody

32167-05111 150 ug
EUR 261

Human Uroplakin 3A (UPK3A) ELISA Kit

DLR-UPK3A-Hu-48T 48T
EUR 517
  • Should the Human Uroplakin 3A (UPK3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroplakin 3A (UPK3A) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit

DLR-UPK3A-Hu-96T 96T
EUR 673
  • Should the Human Uroplakin 3A (UPK3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroplakin 3A (UPK3A) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit

20-abx153447
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Uroplakin- 1a, UPK1A ELISA KIT

ELI-16916h 96 Tests
EUR 824

Human Uroplakin- 1b, UPK1B ELISA KIT

ELI-17772h 96 Tests
EUR 824

Human Uroplakin- 3b, UPK3B ELISA KIT

ELI-28579h 96 Tests
EUR 824

Human Uroplakin- 3a, UPK3A ELISA KIT

ELI-28840h 96 Tests
EUR 824

Human Uroplakin-1a (UPK1A) ELISA Kit

abx384140-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Uroplakin-3b (UPK3B) ELISA Kit

abx384142-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Uroplakin 3B(UPK3B)ELISA Kit

QY-E02049 96T
EUR 374

Human Uroplakin 3A(UPK3A)ELISA Kit

QY-E02050 96T
EUR 374

Human Uroplakin 1B(UPK1B)ELISA Kit

QY-E02052 96T
EUR 361

Human Uroplakin 1A(UPK1A)ELISA Kit

QY-E02053 96T
EUR 361

Human Uroplakin 3A (UPK3A) ELISA Kit

RDR-UPK3A-Hu-48Tests 48 Tests
EUR 544

Human Uroplakin 3A (UPK3A) ELISA Kit

RDR-UPK3A-Hu-96Tests 96 Tests
EUR 756

Human Uroplakin 3A ELISA Kit (UPK3A)

RK02482 96 Tests
EUR 521

Human Uroplakin 3A (UPK3A) ELISA Kit

RD-UPK3A-Hu-48Tests 48 Tests
EUR 521

Human Uroplakin 3A (UPK3A) ELISA Kit

RD-UPK3A-Hu-96Tests 96 Tests
EUR 723

Human Uroplakin 3A (UPK3A) ELISA Kit

SEF558Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit

SEF558Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit

SEF558Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit

SEF558Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit

4-SEF558Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Uroplakin 3A elisa. Alternative names of the recognized antigen: UPIII
  • UPK3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uroplakin 3A (UPK3A) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

UPK2 antibody

70R-21174 50 ul
EUR 435
Description: Rabbit polyclonal UPK2 antibody

UPK2 Antibody

1-CSB-PA025656GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UPK2. Recognizes UPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

UPK2 siRNA

20-abx939075
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ELISA kit for Human UPK3A (Uroplakin 3A)

ELK3941 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroplakin 3A (UPK3A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uroplakin 3A
  • Show more
Description: A sandwich ELISA kit for detection of Uroplakin 3A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Uroplakin-3a (UPK3A)

KTE60086-48T 48T
EUR 332
  • Uroplakins (UPK) are integral membrane proteins that form 2-dimensional crystalline arrays termed urothelial plaques that cover more than 90% of the apical urothelial surface. The asymmetric unit membrane (AUM) forms the apical plaques of urothelium
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Uroplakin-3a (UPK3A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Uroplakin-3a (UPK3A)

KTE60086-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Uroplakins (UPK) are integral membrane proteins that form 2-dimensional crystalline arrays termed urothelial plaques that cover more than 90% of the apical urothelial surface. The asymmetric unit membrane (AUM) forms the apical plaques of urothelium
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Uroplakin-3a (UPK3A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Uroplakin-3a (UPK3A)

KTE60086-96T 96T
EUR 539
  • Uroplakins (UPK) are integral membrane proteins that form 2-dimensional crystalline arrays termed urothelial plaques that cover more than 90% of the apical urothelial surface. The asymmetric unit membrane (AUM) forms the apical plaques of urothelium
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Uroplakin-3a (UPK3A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

UPK2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2591903 1.0 ug DNA
EUR 154

Human UPK2 shRNA Plasmid

20-abx955048
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UPK2 Recombinant Protein (Human)

RP044683 100 ug Ask for price

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Rat Uroplakin 3A (UPK3A) ELISA Kit

20-abx258070
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Uroplakin- 1a, Upk1a ELISA KIT

ELI-16720m 96 Tests
EUR 865

Bovine Uroplakin- 3a, UPK3A ELISA KIT

ELI-16722b 96 Tests
EUR 928

Mouse Uroplakin- 3a, Upk3a ELISA KIT

ELI-16917m 96 Tests
EUR 865

Bovine Uroplakin- 3b, UPK3B ELISA KIT

ELI-17773b 96 Tests
EUR 928

Bovine Uroplakin- 1b, UPK1B ELISA KIT

ELI-51205b 96 Tests
EUR 928

Mouse Uroplakin- 3b, Upk3b ELISA KIT

ELI-44711m 96 Tests
EUR 865

Mouse Uroplakin- 1b, Upk1b ELISA KIT

ELI-40638m 96 Tests
EUR 865

Bovine Uroplakin- 1a, UPK1A ELISA KIT

ELI-36739b 96 Tests
EUR 928

Rat Uroplakin 3A (UPK3A) ELISA Kit

SEF558Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Rat Uroplakin 3A (UPK3A) ELISA Kit

SEF558Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Rat Uroplakin 3A (UPK3A) ELISA Kit

SEF558Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Rat Uroplakin 3A (UPK3A) ELISA Kit

SEF558Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Rat Uroplakin 3A (UPK3A) ELISA Kit

4-SEF558Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Uroplakin 3A elisa. Alternative names of the recognized antigen: UPIII
  • UPK3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Uroplakin 3A (UPK3A) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Uroplakin-2 (UP2) Antibody (Biotin Conjugate)

32167-05121 150 ug
EUR 369

Human Uroplakin- 3b- like protein, UPK3BL ELISA KIT

ELI-39865h 96 Tests
EUR 824

Human Uroplakin 3A (UPK3A) CLIA Kit

20-abx494949
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

UPK2 Polyclonal Antibody

27504-100ul 100ul
EUR 252

UPK2 Polyclonal Antibody

27504-50ul 50ul
EUR 187

UPK2 Rabbit pAb

A10813-100ul 100 ul
EUR 308

UPK2 Rabbit pAb

A10813-200ul 200 ul
EUR 459

UPK2 Rabbit pAb

A10813-20ul 20 ul
EUR 183

UPK2 Rabbit pAb

A10813-50ul 50 ul
EUR 223

UPK2 cloning plasmid

CSB-CL025656HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: ATGGCACCCCTGCTGCCCATCCGGACCTTGCCCTTGATCCTGATTCTGCTGGCTCTGCTGTCCCCAGGGGCTGCAGACTTCAACATCTCAAGCCTCTCTGGTCTGCTGTCCCCGGCACTAACGGAGAGCCTGCTGGTTGCCTTGCCCCCCTGTCACCTCACAGGAGGCAATGCCAC
  • Show more
Description: A cloning plasmid for the UPK2 gene.

UPK2 Rabbit pAb

A3338-100ul 100 ul
EUR 308

UPK2 Rabbit pAb

A3338-200ul 200 ul
EUR 459

UPK2 Rabbit pAb

A3338-20ul 20 ul Ask for price

UPK2 Rabbit pAb

A3338-50ul 50 ul Ask for price

anti- UPK2 antibody

FNab09274 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IHC:1:20-1:200
  • Immunogen: uroplakin 2
  • Uniprot ID: O00526
  • Gene ID: 7379
  • Research Area: Developmental biology
Description: Antibody raised against UPK2

anti- UPK2 antibody

FNab09275 100µg
EUR 585
  • Recommended dilution: IHC:1:20-1:200
  • Immunogen: uroplakin 2
  • Uniprot ID: O00526
  • Gene ID: 7379
  • Research Area: Developmental biology
Description: Antibody raised against UPK2

Anti-UPK2 antibody

PAab09274 100 ug
EUR 386

Anti-UPK2 antibody

STJ26047 100 µl
EUR 277
Description: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.

Anti-UPK2 antibody

STJ112709 100 µl
EUR 277
Description: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.

UPK2 ORF Vector (Human) (pORF)

ORF014895 1.0 ug DNA
EUR 354

ELISA kit for Rat UPK3A (Uroplakin 3A)

ELK7360 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroplakin 3A (UPK3A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uroplakin 3A
  • Show more
Description: A sandwich ELISA kit for detection of Uroplakin 3A from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Upk2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6692303 1.0 ug DNA
EUR 154

Upk2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3928803 1.0 ug DNA
EUR 154

Human Uroplakin-2 (UP2) AssayLite Antibody (FITC Conjugate)

32167-05141 150 ug
EUR 428

Human Uroplakin-2 (UP2) AssayLite Antibody (RPE Conjugate)

32167-05151 150 ug
EUR 428

Human Uroplakin-2 (UP2) AssayLite Antibody (APC Conjugate)

32167-05161 150 ug
EUR 428

Human Uroplakin-2 (UP2) AssayLite Antibody (PerCP Conjugate)

32167-05171 150 ug
EUR 471

Uroplakin III Antibody

3620-100
EUR 349

Uroplakin III Antibody

3620-30T
EUR 146

Uroplakin III antibody

10R-U103a 5 mL
EUR 567
Description: Mouse monoclonal Uroplakin III antibody

Uroplakin III antibody

10R-U103ax 50 ug
EUR 554
Description: Mouse monoclonal Uroplakin III antibody

Uroplakin 3A Protein

20-abx262935
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

anti-Uroplakin IIIB

YF-PA21102 50 ug
EUR 363
Description: Mouse polyclonal to Uroplakin IIIB

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Uroplakin 3A (UPK3A) Protein

20-abx168151
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Uroplakin 1A (UPK1A) Protein

20-abx650054
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Anti-Human Uroplakin III antibody

STJ16100436 1 mL
EUR 1822

UPK2 protein (His tag)

30R-2967 100 ug
EUR 322
Description: Purified recombinant Human UPK2 protein (His tag)

UPK2 Polyclonal Conjugated Antibody

C27504 100ul
EUR 397

UPK2 Recombinant Protein (Rat)

RP235937 100 ug Ask for price

UPK2 Recombinant Protein (Mouse)

RP183206 100 ug Ask for price

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

UPK2 sgRNA CRISPR Lentivector set (Human)

K2591901 3 x 1.0 ug
EUR 339

Mouse Uroplakin- 3b- like protein, Upk3bl ELISA KIT

ELI-17750m 96 Tests
EUR 865

Bovine Uroplakin- 3b- like protein, UPK3BL ELISA KIT

ELI-51732b 96 Tests
EUR 928

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Rat Uroplakin 3A (UPK3A) CLIA Kit

20-abx494950
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Uroplakin III Blocking Peptide

3620BP-50
EUR 153

Mouse Uroplakin-3a (Upk3a)

1-CSB-EP862403MO
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 25.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Uroplakin-3a(Upk3a),partial expressed in E.coli

Uroplakin-1b (UPK1B) Antibody

20-abx005710
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroplakin-3b (UPK3B) Antibody

20-abx006282
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroplakin-3b (UPK3B) Antibody

20-abx211420
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroplakin 3A (UPK3A) Antibody

20-abx128350
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uroplakin 3A (UPK3A) Antibody

20-abx130100
  • EUR 328.00
  • EUR 133.00
  • EUR 871.00
  • EUR 453.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uroplakin 1A (UPK1A) Antibody

20-abx131674
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Uroplakin 1A (UPK1A) Antibody

20-abx131675
  • EUR 314.00
  • EUR 133.00
  • EUR 815.00
  • EUR 425.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uroplakin 3A (UPK3A) Antibody

20-abx135952
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroplakin 3A (UPK3A) Antibody

20-abx175044
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Uroplakin 3A (UPK3A) Antibody

20-abx175045
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Uroplakin-3b (UPK3B) Antibody

abx029707-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Uroplakin-3b (UPK3B) Antibody

abx029707-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Uroplakin-1a (UPK1A) Antibody

abx034286-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Human UPK2(Uroplakin 2) ELISA Kit