Human UPK2(Uroplakin 2) ELISA Kit

Human UPK2(Uroplakin 2) ELISA Kit

Human Uroplakin 2 (UPK2) ELISA Kit
SEF561Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit
SEF561Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit
SEF561Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit
SEF561Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit
4-SEF561Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Uroplakin 2 elisa. Alternative names of the recognized antigen: UPII Uroplakin II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uroplakin 2 (UPK2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Uroplakin- 2, Upk2 ELISA KIT
ELI-36741m	Lifescience Market	96 Tests	EUR 865

Bovine Uroplakin- 2, UPK2 ELISA KIT
ELI-28839b	Lifescience Market	96 Tests	EUR 928

Porcine Uroplakin- 2, UPK2 ELISA KIT
ELI-39864p	Lifescience Market	96 Tests	EUR 928

Uroplakin-2 (UPK2) Antibody
20-abx126762	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Uroplakin 2 (UPK2) Antibody
20-abx116547	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Uroplakin 2 (UPK2) Antibody
20-abx131673	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uroplakin-2 (UPK2) Antibody
20-abx002383	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Uroplakin-2 (UPK2) Protein
20-abx261408	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Uroplakin-2 (UPK2) Antibody
abx239274-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Mouse Uroplakin-2 (Upk2)
1-CSB-EP025656MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 40.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Uroplakin-2(Upk2) expressed in E.coli

Recombinant Uroplakin 2 (UPK2)
4-RPF561Hu01	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O00526 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Uroplakin 2 expressed in: E.coli

ELISA kit for Human UPK2 (Uroplakin 2)
ELK5223	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroplakin 2 (UPK2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uroplakin 2 (UP Show more
Description: A sandwich ELISA kit for detection of Uroplakin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Uroplakin 2 (UPK2) CLIA Kit
20-abx494951	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Uroplakin 2 (UPK2) Protein
20-abx650668	Abbexa	EUR 523.00 EUR 244.00 EUR 1497.00 EUR 606.00 EUR 384.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uroplakin 2 (UPK2) Antibody (Cy3)
20-abx274287	Abbexa	EUR 592.00 EUR 286.00 EUR 1887.00 EUR 857.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

UPK2 Uroplakin 2 Human Recombinant Protein
PROTO00526	BosterBio	Regular: 20ug	EUR 317
Description: UPK2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 153 amino acids (26-155 a.a) and having a molecular mass of 16.2kDa.;UPK2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human)
4-PAF561Hu01	Cloud-Clone	EUR 261.00 EUR 2734.00 EUR 676.00 EUR 330.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2)

Recombinant Human Uroplakin-2/UPK2 (C-6His)
CA11-10ug	Novoprotein	10ug	EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)
CA11-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)
CA11-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)
CA11-50ug	Novoprotein	50ug	EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), APC
4-PAF561Hu01-APC	Cloud-Clone	EUR 367.00 EUR 3581.00 EUR 989.00 EUR 470.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with APC.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), Biotinylated
4-PAF561Hu01-Biotin	Cloud-Clone	EUR 327.00 EUR 2684.00 EUR 783.00 EUR 403.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with Biotin.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), Cy3
4-PAF561Hu01-Cy3	Cloud-Clone	EUR 447.00 EUR 4733.00 EUR 1277.00 EUR 585.00 EUR 263.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with Cy3.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), FITC
4-PAF561Hu01-FITC	Cloud-Clone	EUR 313.00 EUR 2884.00 EUR 811.00 EUR 396.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with FITC.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), HRP
4-PAF561Hu01-HRP	Cloud-Clone	EUR 334.00 EUR 3120.00 EUR 873.00 EUR 424.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with HRP.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), PE
4-PAF561Hu01-PE	Cloud-Clone	EUR 313.00 EUR 2884.00 EUR 811.00 EUR 396.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with PE.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), APC-Cy7
4-PAF561Hu01-APC-Cy7	Cloud-Clone	EUR 614.00 EUR 7042.00 EUR 1858.00 EUR 821.00 EUR 337.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with APC-Cy7.

UPK2 ELISA KIT|Human
EF004088	Lifescience Market	96 Tests	EUR 689

UPK2 ELISA Kit (Human) (OKCD00470)
OKCD00470	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Component of the asymmetric unit membrane (AUM); a highly specialized biomembrane elaborated by terminally differentiated urothelial cells. May play an important role in regulating the assembly of the AUM (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL

UPK2 ELISA Kit (Human) (OKAN06386)
OKAN06386	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.053 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Uroplakin-2 (UP2) Antibody
32167-05111	AssayPro	150 ug	EUR 261

Human Uroplakin- 1b, UPK1B ELISA KIT
ELI-17772h	Lifescience Market	96 Tests	EUR 824

Human Uroplakin- 1a, UPK1A ELISA KIT
ELI-16916h	Lifescience Market	96 Tests	EUR 824

Human Uroplakin- 3b, UPK3B ELISA KIT
ELI-28579h	Lifescience Market	96 Tests	EUR 824

Human Uroplakin- 3a, UPK3A ELISA KIT
ELI-28840h	Lifescience Market	96 Tests	EUR 824

Human Uroplakin 3A (UPK3A) ELISA Kit
20-abx153447	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Uroplakin-1a (UPK1A) ELISA Kit
abx384140-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Uroplakin-3b (UPK3B) ELISA Kit
abx384142-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Uroplakin 3A (UPK3A) ELISA Kit
DLR-UPK3A-Hu-48T	DL Develop	48T	EUR 517
Should the Human Uroplakin 3A (UPK3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroplakin 3A (UPK3A) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit
DLR-UPK3A-Hu-96T	DL Develop	96T	EUR 673
Should the Human Uroplakin 3A (UPK3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroplakin 3A (UPK3A) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit
RDR-UPK3A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Uroplakin 3A (UPK3A) ELISA Kit
RDR-UPK3A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Uroplakin 3A ELISA Kit (UPK3A)
RK02482	Abclonal	96 Tests	EUR 521

Human Uroplakin 3A (UPK3A) ELISA Kit
RD-UPK3A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Uroplakin 3A (UPK3A) ELISA Kit
RD-UPK3A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Uroplakin 3B(UPK3B)ELISA Kit
QY-E02049	Qayee Biotechnology	96T	EUR 374

Human Uroplakin 3A(UPK3A)ELISA Kit
QY-E02050	Qayee Biotechnology	96T	EUR 374

Human Uroplakin 1B(UPK1B)ELISA Kit
QY-E02052	Qayee Biotechnology	96T	EUR 361

Human Uroplakin 1A(UPK1A)ELISA Kit
QY-E02053	Qayee Biotechnology	96T	EUR 361

Human Uroplakin 3A (UPK3A) ELISA Kit
SEF558Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit
SEF558Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit
SEF558Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit
SEF558Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit
4-SEF558Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Uroplakin 3A elisa. Alternative names of the recognized antigen: UPIII UPK3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uroplakin 3A (UPK3A) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

UPK2 siRNA
20-abx939075	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UPK2 antibody
70R-21174	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal UPK2 antibody

UPK2 Antibody
1-CSB-PA025656GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UPK2. Recognizes UPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ELISA kit for Human UPK3A (Uroplakin 3A)
ELK3941	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroplakin 3A (UPK3A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uroplakin 3A Show more
Description: A sandwich ELISA kit for detection of Uroplakin 3A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Uroplakin-3a (UPK3A)
KTE60086-48T	Abbkine	48T	EUR 332
Uroplakins (UPK) are integral membrane proteins that form 2-dimensional crystalline arrays termed urothelial plaques that cover more than 90% of the apical urothelial surface. The asymmetric unit membrane (AUM) forms the apical plaques of urothelium Show more
Description: Quantitative sandwich ELISA for measuring Human Uroplakin-3a (UPK3A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Uroplakin-3a (UPK3A)
KTE60086-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Uroplakins (UPK) are integral membrane proteins that form 2-dimensional crystalline arrays termed urothelial plaques that cover more than 90% of the apical urothelial surface. The asymmetric unit membrane (AUM) forms the apical plaques of urothelium Show more
Description: Quantitative sandwich ELISA for measuring Human Uroplakin-3a (UPK3A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Uroplakin-3a (UPK3A)
KTE60086-96T	Abbkine	96T	EUR 539
Uroplakins (UPK) are integral membrane proteins that form 2-dimensional crystalline arrays termed urothelial plaques that cover more than 90% of the apical urothelial surface. The asymmetric unit membrane (AUM) forms the apical plaques of urothelium Show more
Description: Quantitative sandwich ELISA for measuring Human Uroplakin-3a (UPK3A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

UPK2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2591903	ABM	1.0 ug DNA	EUR 154

Human UPK2 shRNA Plasmid
20-abx955048	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

UPK2 Recombinant Protein (Human)
RP044683	ABM	100 ug	Ask for price

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Bovine Uroplakin- 3b, UPK3B ELISA KIT
ELI-17773b	Lifescience Market	96 Tests	EUR 928

Mouse Uroplakin- 1a, Upk1a ELISA KIT
ELI-16720m	Lifescience Market	96 Tests	EUR 865

Bovine Uroplakin- 3a, UPK3A ELISA KIT
ELI-16722b	Lifescience Market	96 Tests	EUR 928

Mouse Uroplakin- 3a, Upk3a ELISA KIT
ELI-16917m	Lifescience Market	96 Tests	EUR 865

Bovine Uroplakin- 1a, UPK1A ELISA KIT
ELI-36739b	Lifescience Market	96 Tests	EUR 928

Mouse Uroplakin- 3b, Upk3b ELISA KIT
ELI-44711m	Lifescience Market	96 Tests	EUR 865

Mouse Uroplakin- 1b, Upk1b ELISA KIT
ELI-40638m	Lifescience Market	96 Tests	EUR 865

Bovine Uroplakin- 1b, UPK1B ELISA KIT
ELI-51205b	Lifescience Market	96 Tests	EUR 928

Rat Uroplakin 3A (UPK3A) ELISA Kit
20-abx258070	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Uroplakin 3A (UPK3A) ELISA Kit
SEF558Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Rat Uroplakin 3A (UPK3A) ELISA Kit
SEF558Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Rat Uroplakin 3A (UPK3A) ELISA Kit
SEF558Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Rat Uroplakin 3A (UPK3A) ELISA Kit
SEF558Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Rat Uroplakin 3A (UPK3A) ELISA Kit
4-SEF558Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Uroplakin 3A elisa. Alternative names of the recognized antigen: UPIII UPK3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Uroplakin 3A (UPK3A) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Uroplakin-2 (UP2) Antibody (Biotin Conjugate)
32167-05121	AssayPro	150 ug	EUR 369

Human Uroplakin- 3b- like protein, UPK3BL ELISA KIT
ELI-39865h	Lifescience Market	96 Tests	EUR 824

UPK2 cloning plasmid
CSB-CL025656HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 555 Sequence: ATGGCACCCCTGCTGCCCATCCGGACCTTGCCCTTGATCCTGATTCTGCTGGCTCTGCTGTCCCCAGGGGCTGCAGACTTCAACATCTCAAGCCTCTCTGGTCTGCTGTCCCCGGCACTAACGGAGAGCCTGCTGGTTGCCTTGCCCCCCTGTCACCTCACAGGAGGCAATGCCAC Show more
Description: A cloning plasmid for the UPK2 gene.

anti- UPK2 antibody
FNab09274	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:2000 IHC：1:20-1:200 Immunogen: uroplakin 2 Uniprot ID: O00526 Gene ID: 7379 Research Area: Developmental biology
Description: Antibody raised against UPK2

anti- UPK2 antibody
FNab09275	FN Test	100µg	EUR 585
Recommended dilution: IHC：1:20-1:200 Immunogen: uroplakin 2 Uniprot ID: O00526 Gene ID: 7379 Research Area: Developmental biology
Description: Antibody raised against UPK2

UPK2 Rabbit pAb
A10813-100ul	Abclonal	100 ul	EUR 308

UPK2 Rabbit pAb
A10813-200ul	Abclonal	200 ul	EUR 459

UPK2 Rabbit pAb
A10813-20ul	Abclonal	20 ul	EUR 183

UPK2 Rabbit pAb
A10813-50ul	Abclonal	50 ul	EUR 223

UPK2 Rabbit pAb
A3338-100ul	Abclonal	100 ul	EUR 308

UPK2 Rabbit pAb
A3338-200ul	Abclonal	200 ul	EUR 459

UPK2 Rabbit pAb
A3338-20ul	Abclonal	20 ul	Ask for price

UPK2 Rabbit pAb
A3338-50ul	Abclonal	50 ul	Ask for price

UPK2 Polyclonal Antibody
27504-100ul	SAB	100ul	EUR 252

UPK2 Polyclonal Antibody
27504-50ul	SAB	50ul	EUR 187

Anti-UPK2 antibody
PAab09274	Lifescience Market	100 ug	EUR 386

Anti-UPK2 antibody
STJ26047	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.

Anti-UPK2 antibody
STJ112709	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.

Human Uroplakin 3A (UPK3A) CLIA Kit
20-abx494949	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

UPK2 ORF Vector (Human) (pORF)
ORF014895	ABM	1.0 ug DNA	EUR 354

ELISA kit for Rat UPK3A (Uroplakin 3A)
ELK7360	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroplakin 3A (UPK3A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uroplakin 3A Show more
Description: A sandwich ELISA kit for detection of Uroplakin 3A from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Upk2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3928803	ABM	1.0 ug DNA	EUR 154

Upk2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6692303	ABM	1.0 ug DNA	EUR 154

Human Uroplakin-2 (UP2) AssayLite Antibody (FITC Conjugate)
32167-05141	AssayPro	150 ug	EUR 428

Human Uroplakin-2 (UP2) AssayLite Antibody (RPE Conjugate)
32167-05151	AssayPro	150 ug	EUR 428

Human Uroplakin-2 (UP2) AssayLite Antibody (APC Conjugate)
32167-05161	AssayPro	150 ug	EUR 428

Human Uroplakin-2 (UP2) AssayLite Antibody (PerCP Conjugate)
32167-05171	AssayPro	150 ug	EUR 471

Uroplakin 3A Protein
20-abx262935	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Uroplakin III Antibody
3620-100	Biovision		EUR 349

Uroplakin III Antibody
3620-30T	Biovision		EUR 146

Uroplakin III antibody
10R-U103a	Fitzgerald	5 mL	EUR 567
Description: Mouse monoclonal Uroplakin III antibody

Uroplakin III antibody
10R-U103ax	Fitzgerald	50 ug	EUR 554
Description: Mouse monoclonal Uroplakin III antibody

anti-Uroplakin IIIB
YF-PA21102	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Uroplakin IIIB

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Uroplakin 1A (UPK1A) Protein
20-abx650054	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Uroplakin 3A (UPK3A) Protein
20-abx168151	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Anti-Human Uroplakin III antibody
STJ16100436	St John's Laboratory	1 mL	EUR 1822

UPK2 Polyclonal Conjugated Antibody
C27504	SAB	100ul	EUR 397

UPK2 protein (His tag)
30R-2967	Fitzgerald	100 ug	EUR 322
Description: Purified recombinant Human UPK2 protein (His tag)

UPK2 Recombinant Protein (Rat)
RP235937	ABM	100 ug	Ask for price

UPK2 Recombinant Protein (Mouse)
RP183206	ABM	100 ug	Ask for price

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

UPK2 sgRNA CRISPR Lentivector set (Human)
K2591901	ABM	3 x 1.0 ug	EUR 339

Mouse Uroplakin- 3b- like protein, Upk3bl ELISA KIT
ELI-17750m	Lifescience Market	96 Tests	EUR 865

Bovine Uroplakin- 3b- like protein, UPK3BL ELISA KIT
ELI-51732b	Lifescience Market	96 Tests	EUR 928

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Rat Uroplakin 3A (UPK3A) CLIA Kit
20-abx494950	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Uroplakin 3A (UPK3A) Antibody
20-abx128350	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uroplakin 3A (UPK3A) Antibody
20-abx130100	Abbexa	EUR 328.00 EUR 133.00 EUR 871.00 EUR 453.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uroplakin 1A (UPK1A) Antibody
20-abx131674	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Uroplakin 1A (UPK1A) Antibody
20-abx131675	Abbexa	EUR 314.00 EUR 133.00 EUR 815.00 EUR 425.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uroplakin 3A (UPK3A) Antibody
20-abx135952	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Uroplakin-1a (UPK1A) Antibody
abx034286-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Uroplakin-1a (UPK1A) Antibody
abx034286-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Uroplakin-3b (UPK3B) Antibody
20-abx006282	Abbexa	EUR 411.00 EUR 592.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Uroplakin-1b (UPK1B) Antibody
20-abx005710	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Uroplakin-3b (UPK3B) Antibody
abx029707-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Uroplakin-3b (UPK3B) Antibody
abx029707-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Uroplakin 3A (UPK3A) Antibody
20-abx175044	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Uroplakin 3A (UPK3A) Antibody
20-abx175045	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Uroplakin 3A (UPK3A) Antibody
20-abx321145	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Uroplakin-1b (UPK1B) Antibody
20-abx321741	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Human UPK2(Uroplakin 2) ELISA Kit