Human THBS3(Thrombospondin 3) ELISA Kit

Human THBS3(Thrombospondin 3) ELISA Kit

Human Thrombospondin 3 (THBS3) ELISA Kit
RDR-THBS3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Thrombospondin 3 (THBS3) ELISA Kit
RDR-THBS3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Thrombospondin 3 (THBS3) ELISA Kit
DLR-THBS3-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 3 (THBS3) in samples from plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit
DLR-THBS3-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 3 (THBS3) in samples from plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit
RDR-THBS3-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Thrombospondin 3 (THBS3) ELISA Kit
RDR-THBS3-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Thrombospondin 3 (THBS3) ELISA Kit
20-abx156876	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Thrombospondin 3 (THBS3) ELISA Kit
abx259888-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Thrombospondin- 3, THBS3 ELISA KIT
ELI-36583h	Lifescience Market	96 Tests	EUR 824

Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit
4-SED823Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species.

Mouse Thrombospondin 3 (THBS3) ELISA Kit
20-abx154756	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Thrombospondin- 3, Thbs3 ELISA KIT
ELI-17025m	Lifescience Market	96 Tests	EUR 865

Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit
4-SED823Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human THBS3 (Thrombospondin 3)
ELK5166	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Thrombospondin 3 (THBS3) CLIA Kit
20-abx494398	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Thrombospondin-3 (Thbs3)
1-CSB-EP023489MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 62.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in E.coli

Mouse Thrombospondin-3 (Thbs3)
1-CSB-YP023489MO	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 37.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in Yeast

Thrombospondin 3 (THBS3) Antibody
20-abx178573	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Thrombospondin 3 (THBS3) Antibody
20-abx178574	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Thrombospondin 3 (THBS3) Antibody
20-abx110655	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody
20-abx110656	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody
20-abx116967	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody
20-abx123257	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody
20-abx128997	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thrombospondin 3 (THBS3) Antibody
abx030681-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody
abx030681-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody
abx238675-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Thrombospondin 3 (THBS3) Antibody
20-abx320416	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody
abx431668-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Recombinant Thrombospondin 3 (THBS3)
4-RPD823Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P49746 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 58.1kDa Isoelectric Point: Inquire
Description: Recombinant Human Thrombospondin 3 expressed in: E.coli

Human Thrombospondin 3 (THBS3) Protein
20-abx166577	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Mouse THBS3 (Thrombospondin 3)
ELK6457	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Thrombospondin 3 (THBS3) CLIA Kit
20-abx494399	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Thrombospondin 3 (THBS3) Antibody (Biotin)
20-abx106391	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (Biotin)
20-abx106392	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (FITC)
20-abx107803	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (FITC)
20-abx107804	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (HRP)
20-abx109221	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (HRP)
20-abx109222	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse Thrombospondin 3 (THBS3) Protein
20-abx655225	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Thrombospondin 3 (THBS3) Protein
20-abx655226	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human)
4-PAD823Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3)

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC
4-PAD823Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Biotinylated
4-PAD823Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Biotin.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Cy3
4-PAD823Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Cy3.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), FITC
4-PAD823Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with FITC.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), HRP
4-PAD823Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with HRP.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), PE
4-PAD823Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with PE.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC-Cy7
4-PAD823Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THBS3 (Asp670~Cys921) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC-Cy7.

Polyclonal THBS3 / Thrombospondin 3 Antibody (C-Terminus)
AMM08184G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human THBS3 / Thrombospondin 3 (C-Terminus). This antibody is tested and proven to work in the following applications:

THBS3 ELISA Kit (Human) (OKCD00691)
OKCD00691	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. Can bind to fibrinogen, fibronectin, laminin and type V collagen. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.61 ng/mL

Thrombospondin 3 ELISA KIT|Human
EF003592	Lifescience Market	96 Tests	EUR 689

Thbs3 ELISA Kit (Mouse) (OKCD01781)
OKCD01781	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. Can bind to fibrinogen, fibronectin, laminin and type V collagen. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 25.3 pg/mL

Human Thrombospondin 3 (TSP-3)ELISA Kit
201-12-2387	SunredBio	96 tests	EUR 440
This Thrombospondin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Thrombospondin 3(TSP-3)ELISA Kit
QY-E00634	Qayee Biotechnology	96T	EUR 361

THBS3 antibody
70R-21720	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal THBS3 antibody

Thbs3 Antibody
1-CSB-PA023489DA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

Thbs3 Antibody
1-CSB-PA023489EA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

THBS3 Antibody
1-CSB-PA023489ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

THBS3 Antibody
1-CSB-PA023489GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

THBS3 siRNA
20-abx936680	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

THBS3 siRNA
20-abx936681	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human THBS3 shRNA Plasmid
20-abx954831	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

THBS3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2368904	ABM	1.0 ug DNA	EUR 154

Human Thrombospondin 1 ELISA kit
E01T0763-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 1 ELISA kit
E01T0763-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 1 ELISA kit
E01T0763-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin-2 ELISA kit
LF-EK50605	Abfrontier	1×96T	EUR 648

THBS3 cloning plasmid
CSB-CL023489HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1458 Sequence: ATGGACAACAACAAACACTGCAAACAGGACAACTGCCTTTTGACACCCAACTCTGGGCAGGAAGATGCTGATAATGATGGTGTGGGGGACCAGTGTGATGATGATGCTGATGGGGATGGGATCAAGAATGTTGAGGACAACTGCCGGCTGTTCCCCAACAAAGACCAGCAGAACT Show more
Description: A cloning plasmid for the THBS3 gene.

Thbs3 Polyclonal Antibody
A57726	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Thbs3 Polyclonal Antibody
A57777	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

THBS3 Rabbit pAb
A3641-100ul	Abclonal	100 ul	EUR 308

THBS3 Rabbit pAb
A3641-200ul	Abclonal	200 ul	EUR 459

THBS3 Rabbit pAb
A3641-20ul	Abclonal	20 ul	EUR 183

THBS3 Rabbit pAb
A3641-50ul	Abclonal	50 ul	EUR 223

Anti-THBS3 antibody
STJ25845	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants.

Anti-THBS3 antibody
STJ71847	St John's Laboratory	100 µg	EUR 359

FSH (Human Follicle-stimulating hormone) ELISA test
3	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)

THBS3 ORF Vector (Human) (pORF)
ORF014707	ABM	1.0 ug DNA	EUR 354

Human Thrombospondin 1 (THBS1) ELISA Kit
DLR-THBS1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Thrombospondin 1 (THBS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 1 (THBS1) in samples from plasma.

Human Thrombospondin 1 (THBS1) ELISA Kit
DLR-THBS1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Thrombospondin 1 (THBS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 1 (THBS1) in samples from plasma.

Human Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Hu-48T	DL Develop	48T	EUR 387
Should the Human Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.

Human Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Hu-96T	DL Develop	96T	EUR 494
Should the Human Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.

Human Thrombospondin 4 (THBS4) ELISA Kit
DLR-THBS4-Hu-48T	DL Develop	48T	EUR 517
Should the Human Thrombospondin 4 (THBS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 4 (THBS4) in samples from serum, plasma or other biological fluids.

Human Thrombospondin 4 (THBS4) ELISA Kit
DLR-THBS4-Hu-96T	DL Develop	96T	EUR 673
Should the Human Thrombospondin 4 (THBS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 4 (THBS4) in samples from serum, plasma or other biological fluids.

Human Thrombospondin-2(THBS2) ELISA kit
CSB-EL023488HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Thrombospondin-2 (THBS2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Thrombospondin-2(THBS2) ELISA kit
1-CSB-EL023488HU	Cusabio	EUR 602.00 EUR 4238.00 EUR 2256.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Thrombospondin-2(THBS2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Thrombospondin-4(THBS4) ELISA kit
CSB-EL023490HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Thrombospondin-4 (THBS4) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Thrombospondin-4(THBS4) ELISA kit
1-CSB-EL023490HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Thrombospondin-4(THBS4) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Thrombospondin 1(THBS1) ELISA kit
E01T0686-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 1(THBS1) ELISA kit
E01T0686-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 1(THBS1) ELISA kit
E01T0686-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 2(THBS2) ELISA kit
E01T0687-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 2(THBS2) ELISA kit
E01T0687-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 2(THBS2) ELISA kit
E01T0687-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin-2 (JAK2) ELISA Kit
abx050226-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

Human Thrombospondin 1 (THBS1) ELISA Kit
abx052577-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-10 working days.

Human Thrombospondin 1 (THBS1) ELISA Kit
20-abx153283	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Thrombospondin 2 (THBS2) ELISA Kit
20-abx153284	Abbexa	EUR 5311.00 EUR 2837.00 EUR 668.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Thrombospondin 4 (THBS4) ELISA Kit
20-abx153285	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Thrombospondin 4 (THBS4) ELISA Kit
abx253753-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human Thrombospondin 2 (THBS2) ELISA Kit
abx250162-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Thrombospondin 1 (THBS1) ELISA Kit
abx253325-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Thrombospondin 4 (THBS4) ELISA Kit
abx253326-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human THBS1/ Thrombospondin-1 ELISA Kit
E2490Hu	Sunlong	1 Kit	EUR 537

Human THBS2/ Thrombospondin-2 ELISA Kit
E2491Hu	Sunlong	1 Kit	EUR 537

Human THBS4/ Thrombospondin-4 ELISA Kit
E2492Hu	Sunlong	1 Kit	EUR 571

Human THBS4(Thrombospondin-4) ELISA Kit
EH0795	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P35443 Alias: TSP-4(Thrombospondin-4)/THBS4
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Thrombospondin- 1, THBS1 ELISA KIT
ELI-02195h	Lifescience Market	96 Tests	EUR 824

Human Thrombospondin- 2, THBS2 ELISA KIT
ELI-06100h	Lifescience Market	96 Tests	EUR 824

Human Thrombospondin 4 (THBS4) ELISA Kit
abx571192-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Thrombospondin 1 (THBS1) ELISA Kit
abx571959-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Thrombospondin 2 (THBS2) ELISA Kit
abx576059-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Thrombospondin-2 ELISA kit (4X96T)
LF-EK50606	Abfrontier	4×96T	EUR 2201

Human Thrombospondin 1 (THBS1) ELISA Kit
RDR-THBS1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Thrombospondin 1 (THBS1) ELISA Kit
RDR-THBS1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 390

Human Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 536

Human Thrombospondin 4 (THBS4) ELISA Kit
RDR-THBS4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Thrombospondin 4 (THBS4) ELISA Kit
RDR-THBS4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Thrombospondin 1 ELISA Kit (THBS1)
RK02384	Abclonal	96 Tests	EUR 521

Human THBS3(Thrombospondin 3) ELISA Kit