Human KTN1(Kinectin 1) ELISA Kit

Human KTN1(Kinectin 1) ELISA Kit

Human Kinectin 1 (KTN1) ELISA Kit
SEC558Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kinectin 1 (KTN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kinectin 1 (KTN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Kinectin 1 (KTN1) ELISA Kit
SEC558Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kinectin 1 (KTN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kinectin 1 (KTN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Kinectin 1 (KTN1) ELISA Kit
4-SEC558Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Kinectin 1 elisa. Alternative names of the recognized antigen: CG1 KNT Kinesin Receptor CG-1 antigen Kinesin receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kinectin 1 (KTN1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Kinectin, KTN1 ELISA KIT
ELI-43334h	Lifescience Market	96 Tests	EUR 824

Kinectin 1 (KTN1) Antibody
20-abx004510	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Kinectin 1 (KTN1) Antibody
20-abx113377	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Kinectin 1 (KTN1) Antibody
20-abx130873	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Kinectin 1 (KTN1) Antibody
20-abx130874	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Kinectin 1 (KTN1) Antibody
abx146420-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Kinectin 1 (KTN1) Antibody
20-abx338653	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Kinectin 1 (KTN1) Antibody
abx234660-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Kinectin 1 (KTN1)
4-RPC558Hu01	Cloud-Clone	EUR 444.06 EUR 222.00 EUR 1390.24 EUR 530.08 EUR 960.16 EUR 360.00 EUR 3325.60	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q86UP2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.2kDa Isoelectric Point: Inquire
Description: Recombinant Human Kinectin 1 expressed in: E.coli

Recombinant Kinectin 1 (KTN1)
4-RPC558Ra01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: D4A4Z9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.8kDa Isoelectric Point: Inquire
Description: Recombinant Rat Kinectin 1 expressed in: E.coli

Human Kinectin 1 (KTN1) Protein
20-abx650030	Abbexa	EUR 620.00 EUR 272.00 EUR 1873.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Human KTN1 (Kinectin 1)
ELK5160	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kinectin 1 (KTN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kinectin 1 (KTN1 Show more
Description: A sandwich ELISA kit for detection of Kinectin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Kinectin 1 (KTN1) CLIA Kit
20-abx493764	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Kinectin, Ktn1 ELISA KIT
ELI-08766m	Lifescience Market	96 Tests	EUR 865

Chicken Kinectin, KTN1 ELISA KIT
ELI-12505c	Lifescience Market	96 Tests	EUR 928

ELISA kit for Human Kinectin (KTN1)
KTE61871-48T	Abbkine	48T	EUR 332
Kinectin is a protein encoded by the KTN1 gene.Various cellular organelles and vesicles are transported along the microtubules in the cytoplasm. Likewise, membrane recycling of the endoplasmic reticulum (ER), Golgi assembly at the microtubule organiz Show more
Description: Quantitative sandwich ELISA for measuring Human Kinectin (KTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kinectin (KTN1)
KTE61871-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Kinectin is a protein encoded by the KTN1 gene.Various cellular organelles and vesicles are transported along the microtubules in the cytoplasm. Likewise, membrane recycling of the endoplasmic reticulum (ER), Golgi assembly at the microtubule organiz Show more
Description: Quantitative sandwich ELISA for measuring Human Kinectin (KTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kinectin (KTN1)
KTE61871-96T	Abbkine	96T	EUR 539
Kinectin is a protein encoded by the KTN1 gene.Various cellular organelles and vesicles are transported along the microtubules in the cytoplasm. Likewise, membrane recycling of the endoplasmic reticulum (ER), Golgi assembly at the microtubule organiz Show more
Description: Quantitative sandwich ELISA for measuring Human Kinectin (KTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Kinectin 1 (KTN1) Antibody (HRP)
20-abx336246	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Kinectin 1 (KTN1) Antibody (FITC)
20-abx336247	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Kinectin 1 (KTN1) Antibody (Biotin)
20-abx336248	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rat Kinectin 1 (KTN1) Protein
20-abx650031	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig)
4-PAC558Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1104~Glu1357) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1)

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat)
4-PAC558Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1162~Lys1325) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1)

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), APC
4-PAC558Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1104~Glu1357) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with APC.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAC558Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1104~Glu1357) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with Biotin.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), Cy3
4-PAC558Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1104~Glu1357) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with Cy3.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), FITC
4-PAC558Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1104~Glu1357) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with FITC.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), HRP
4-PAC558Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1104~Glu1357) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with HRP.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), PE
4-PAC558Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1104~Glu1357) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with PE.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), APC
4-PAC558Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1162~Lys1325) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with APC.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAC558Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1162~Lys1325) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with Biotin.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), Cy3
4-PAC558Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1162~Lys1325) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with Cy3.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), FITC
4-PAC558Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1162~Lys1325) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with FITC.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), HRP
4-PAC558Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1162~Lys1325) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with HRP.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), PE
4-PAC558Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1162~Lys1325) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with PE.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAC558Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1104~Glu1357) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with APC-Cy7.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAC558Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KTN1 (Glu1162~Lys1325) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

KTN1 ELISA KIT|Human
EF010598	Lifescience Market	96 Tests	EUR 689

Kinectin 1 antibody
70R-6709	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Kinectin 1 antibody

KTN1 ELISA Kit (Human) (OKCD01205)
OKCD01205	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Receptor for kinesin thus involved in kinesin-driven vesicle motility. Accumulates in integrin-based adhesion complexes (IAC) upon integrin aggregation by fibronectin. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 30 pg/mL

Recombinant human Kinectin
P2662	FN Test	100ug	Ask for price
Uniprot ID: Q86UP2 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Kinectin

Kinectin 1 Blocking Peptide
33R-2373	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KTN1 antibody, catalog no. 70R-6709

KTN1 antibody
70R-18197	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal KTN1 antibody

KTN1 antibody
38704-100ul	SAB	100ul	EUR 252

KTN1 Antibody
1-CSB-PA773030LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IP:1:200-1:2000

KTN1 Antibody
1-CSB-PA012700GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

KTN1 siRNA
20-abx922172	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KTN1 siRNA
20-abx922173	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Human KTN1 shRNA Plasmid
20-abx952639	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

KTN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1191202	ABM	1.0 ug DNA	EUR 154

KTN1 Rabbit pAb
A14016-100ul	Abclonal	100 ul	EUR 308

KTN1 Rabbit pAb
A14016-200ul	Abclonal	200 ul	EUR 459

KTN1 Rabbit pAb
A14016-20ul	Abclonal	20 ul	EUR 183

KTN1 Rabbit pAb
A14016-50ul	Abclonal	50 ul	EUR 223

KTN1 Rabbit pAb
A12456-100ul	Abclonal	100 ul	EUR 308

KTN1 Rabbit pAb
A12456-200ul	Abclonal	200 ul	EUR 459

KTN1 Rabbit pAb
A12456-20ul	Abclonal	20 ul	EUR 183

KTN1 Rabbit pAb
A12456-50ul	Abclonal	50 ul	EUR 223

KTN1 Conjugated Antibody
C38704	SAB	100ul	EUR 397

KTN1 cloning plasmid
CSB-CL773030HU-10ug	Cusabio	10ug	EUR 1377
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3921 Sequence: atggagttttatgagtcagcatattttattgttcttattccttcaatagttattacagtaattttcctcttcttctggcttttcatgaaagaaacattatatgatgaagttcttgcaaaacagaaaagagaacaaaagcttattcctaccaaaacagataaaaagaaagcagaaa Show more
Description: A cloning plasmid for the KTN1 gene.

KTN1 Rabbit pAb
A5879-100ul	Abclonal	100 ul	EUR 308

KTN1 Rabbit pAb
A5879-200ul	Abclonal	200 ul	EUR 459

KTN1 Rabbit pAb
A5879-20ul	Abclonal	20 ul	EUR 183

KTN1 Rabbit pAb
A5879-50ul	Abclonal	50 ul	EUR 223

KTN1 Polyclonal Antibody
A69971	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

anti- KTN1 antibody
FNab04660	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: kinectin 1 (kinesin receptor) Uniprot ID: Q86UP2 Gene ID: 3895 Research Area: Signal Transduction
Description: Antibody raised against KTN1

Anti-KTN1 antibody
PAab04660	Lifescience Market	100 ug	EUR 386

Anti-KTN1 antibody
STJ28152	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an integral membrane protein that is a member of the kinectin protein family. The encoded protein is primarily localized to the endoplasmic reticulum membrane. This protein binds kinesin and may be involved in intracellular organelle motility. This protein also binds translation elongation factor-delta and may be involved in the assembly of the elongation factor-1 complex. Alternate splicing results in multiple transcript variants of this gene.

Anti-KTN1 antibody
STJ114330	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an integral membrane protein that is a member of the kinectin protein family. The encoded protein is primarily localized to the endoplasmic reticulum membrane. This protein binds kinesin and may be involved in intracellular organelle motility. This protein also binds translation elongation factor-delta and may be involved in the assembly of the elongation factor-1 complex. Alternate splicing results in multiple transcript variants of this gene.

Anti-KTN1 antibody
STJ115951	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an integral membrane protein that is a member of the kinectin protein family. The encoded protein is primarily localized to the endoplasmic reticulum membrane. This protein binds kinesin and may be involved in intracellular organelle motility. This protein also binds translation elongation factor-delta and may be involved in the assembly of the elongation factor-1 complex. Alternate splicing results in multiple transcript variants of this gene.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

KTN1 ORF Vector (Human) (pORF)
ORF013543	ABM	1.0 ug DNA	EUR 354

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

KTN1 Antibody, HRP conjugated
1-CSB-PA773030LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KTN1 Antibody, FITC conjugated
1-CSB-PA773030LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KTN1 Antibody, Biotin conjugated
1-CSB-PA773030LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse KTN1 shRNA Plasmid
20-abx971260	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

Ktn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4810402	ABM	1.0 ug DNA	EUR 154

KTN1 sgRNA CRISPR Lentivector set (Human)
K1191201	ABM	3 x 1.0 ug	EUR 339

KTN1-AS1 ORF Vector (Human) (pORF)
ORF022577	ABM	1.0 ug DNA	Ask for price

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Human Lipocalin-1 (LCN1) AssayMax ELISA Kit
EL3502-1	AssayPro	96 Well Plate	EUR 477

Human TGF-beta-1 AssayMax ELISA Kit
ET3102-1	AssayPro	96 Well Plate	EUR 477

Human PAI-1/tPA AssayMax ELISA Kit
EP1105-1	AssayPro	96 Well Plate	EUR 417

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1	AssayPro	96 Well Plate	EUR 477

Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit
EI2200-1	AssayPro	96 Well Plate	EUR 477

Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit
EI2301-1	AssayPro	96 Well Plate	EUR 477

Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit
EP1100-1	AssayPro	96 Well Plate	EUR 417

KTN1 Polyclonal Antibody, HRP Conjugated
A69972	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research

KTN1 Polyclonal Antibody, FITC Conjugated
A69973	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

KTN1 Polyclonal Antibody, Biotin Conjugated
A69974	EpiGentek	100 ?g	EUR 628.55
Description: reagents widely cited

Ktn1 ORF Vector (Mouse) (pORF)
ORF048908	ABM	1.0 ug DNA	EUR 506

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

KTN1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1191203	ABM	1.0 ug DNA	EUR 154

KTN1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1191204	ABM	1.0 ug DNA	EUR 154

KTN1 Protein Vector (Human) (pPB-C-His)
PV054169	ABM	500 ng	EUR 481

KTN1 Protein Vector (Human) (pPB-N-His)
PV054170	ABM	500 ng	EUR 481

KTN1 Protein Vector (Human) (pPM-C-HA)
PV054171	ABM	500 ng	EUR 481

KTN1 Protein Vector (Human) (pPM-C-His)
PV054172	ABM	500 ng	EUR 481

Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit
EC5752-1	AssayPro	96 Well Plate	EUR 477

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit
EA5001-1	AssayPro	96 Well Plate	EUR 417

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit
EA5101-1	AssayPro	96 Well Plate	EUR 417

Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit
EA5501-1	AssayPro	96 Well Plate	EUR 417

Human KTN1(Kinectin 1) ELISA Kit