Human HRSP12(Heat Responsive Protein 12) ELISA Kit

Human HRSP12(Heat Responsive Protein 12) ELISA Kit

Human Heat Responsive Protein 12 (HRSP12) ELISA Kit

4-SEH883Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Heat Responsive Protein 12 elisa. Alternative names of the recognized antigen: PSP
  • P14.5
  • UK114
  • Ribonuclease UK114
  • 14.5 kDa translational inhibitor protein
  • Heat-responsive protein 12
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Heat Responsive Protein 12 (HRSP12) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Heat Responsive Protein 12 (HRSP12) ELISA Kit

abx391439-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Heat Responsive Protein 12 (HRSP12) ELISA Kit

abx389509-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Heat Responsive Protein 12 (HRSP12) CLIA Kit

20-abx495572
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human HRSP12 (Heat Responsive Protein 12)

ELK5235 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Heat Responsive Protein 12 (HRSP12). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
  • Show more
Description: A sandwich ELISA kit for detection of Heat Responsive Protein 12 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

HRSP12 Heat-Responsive Protein 12 Human Recombinant Protein

PROTP52758 Regular: 20ug
EUR 317
Description: HRSP12 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 157 amino acids (1-137 a.a.) and having a molecular mass of 16.6kDa. The HRSP12 is purified by proprietary chromatographic techniques.

Recombinant Human Heat-Responsive Protein 12/HRSP12 (N-6His)

C256-10ug 10ug
EUR 131
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 8.0.

Recombinant Human Heat-Responsive Protein 12/HRSP12 (N-6His)

C256-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 8.0.

Recombinant Human Heat-Responsive Protein 12/HRSP12 (N-6His)

C256-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 8.0.

Recombinant Human Heat-Responsive Protein 12/HRSP12 (N-6His)

C256-50ug 50ug
EUR 272
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 8.0.

Heat-Responsive Protein 12 Protein

20-abx260828
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Heat-Responsive Protein 12 Antibody

20-abx112950
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Human Heat-Responsive Protein 12

7-05386 5µg Ask for price

Recombinant Human Heat-Responsive Protein 12

7-05387 20µg Ask for price

Recombinant Human Heat-Responsive Protein 12

7-05388 1mg Ask for price

Hrsp12/ Rat Hrsp12 ELISA Kit

ELI-39860r 96 Tests
EUR 886

Human 12-lipoxygenase,LOX-12 ELISA Kit

201-12-0949 96 tests
EUR 440
  • This 12-lipoxygenase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

HRSP12 ELISA KIT|Human

EF010222 96 Tests
EUR 689

Human Interleukin 12,IL-12/P70 ELISA KIT

201-12-0100 96 tests
EUR 440
  • This Interleukin 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 12,IL-12/P40 ELISA KIT

201-12-0101 96 tests
EUR 440
  • This Interleukin 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

HRSP12 ELISA Kit (Human) (OKCD01975)

OKCD01975 96 Wells
EUR 831
Description: Description of target: Endoribonuclease responsible for the inhibition of the translation by cleaving mRNA. Inhibits cell-free protein synthesis. Cleaves phosphodiester bonds only in single-stranded RNA.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

Human Heat Shock Protein 47 (HSP47)ELISA kit

201-12-3251 96 tests
EUR 440
  • This Heat Shock Protein 47 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human cysteinyl aspartate specific proteinases 12,Caspase-12 ELISA Kit

201-12-0763 96 tests
EUR 440
  • This cysteinyl aspartate specific proteinases 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human apelin 12,AP12 ELISA Kit

201-12-0131 96 tests
EUR 440
  • This apelin 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 12 (CLDN12)ELISA kit

201-12-2311 96 tests
EUR 440
  • This Claudin 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Syntaxin 12 (STX12)ELISA Kit

201-12-2582 96 tests
EUR 440
  • This Syntaxin 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Lipocalin 12 (LCN12)ELISA Kit

201-12-2791 96 tests
EUR 440
  • This Lipocalin 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Galectin 12 (GAL12) ELISA kit

201-12-3234 96 tests
EUR 440
  • This Galectin 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock Protein 40,HSP-40 ELISA Kit

201-12-1770 96 tests
EUR 440
  • This Heat Shock Protein 40 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock Protein 60,HSP-60 ELISA Kit

201-12-1775 96 tests
EUR 440
  • This Heat Shock Protein 60 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock Protein 20,HSP-20 ELISA Kit

201-12-1777 96 tests
EUR 440
  • This Heat Shock Protein 20 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human heat shock protein 27,HSP-27 ELISA Kit

201-12-1787 96 tests
EUR 440
  • This heat shock protein 27 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock Protein 90,HSP-90 ELISA Kit

201-12-1805 96 tests
EUR 440
  • This Heat Shock Protein 90 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock Protein 70,HSP-70 ELISA Kit

201-12-1814 96 tests
EUR 440
  • This Heat Shock Protein 70 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock Protein 72,HSP-72 ELISA Kit

201-12-1929 96 tests
EUR 440
  • This Heat Shock Protein 72 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock 70kDa Protein 5 (HSPA5)ELISA kit

201-12-3243 96 tests
EUR 440
  • This Heat Shock 70kDa Protein 5 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock 70kDa Protein 1B (HSPA1B)ELISA kit

201-12-3246 96 tests
EUR 440
  • This Heat Shock 70kDa Protein 1B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock 70kDa Protein 8 (HSPA8)ELISA kit

201-12-3248 96 tests
EUR 440
  • This Heat Shock 70kDa Protein 8 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock Protein Beta 2 (HSPb2)ELISA kit

201-12-3249 96 tests
EUR 440
  • This Heat Shock Protein Beta 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock 70kDa Protein 1A (HSPA1A)ELISA kit

201-12-3253 96 tests
EUR 440
  • This Heat Shock 70kDa Protein 1A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock 70kDa Protein 4 (HSPA4)ELISA kit

201-12-3254 96 tests
EUR 440
  • This Heat Shock 70kDa Protein 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock 70kDa Protein 9 (HSPA9)ELISA kit

201-12-3255 96 tests
EUR 440
  • This Heat Shock 70kDa Protein 9 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock 10kDa Protein 1 (HSP10)ELISA kit

201-12-3256 96 tests
EUR 440
  • This Heat Shock 10kDa Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Glucose Transporter 12 (GLUT12)ELISA kit

201-12-2217 96 tests
EUR 440
  • This Glucose Transporter 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Sorting Nexin 12 (SNX12)ELISA Kit

201-12-2546 96 tests
EUR 440
  • This Sorting Nexin 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Carbohydrate Sulfotransferase 12 (CHST12)ELISA Kit

201-12-2870 96 tests
EUR 440
  • This Carbohydrate Sulfotransferase 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

HRSP12 Recombinant Protein (Human)

RP015223 100 ug Ask for price

Human Ribonuclease UK114, HRSP12 ELISA KIT

ELI-51363h 96 Tests
EUR 824

Human Heat Shock 70kDa Protein 1 Like Protein (HSPA1L)ELISA kit

201-12-3244 96 tests
EUR 440
  • This Heat Shock 70kDa Protein 1 Like Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock Protein glycoprotein 96,HSP gp96 ELISA Kit

201-12-1654 96 tests
EUR 440
  • This Heat Shock Protein glycoprotein 96 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock Protein 90kDa Alpha A1 (HSP90aA1)ELISA kit

201-12-3240 96 tests
EUR 440
  • This Heat Shock Protein 90kDa Alpha A1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock Protein 90kDa Beta 1 (HSP90b1)ELISA kit

201-12-3250 96 tests
EUR 440
  • This Heat Shock Protein 90kDa Beta 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock Factor 1,HSF1 ELISA Kit

201-12-1779 96 tests
EUR 440
  • This Heat Shock Factor 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human 20-hydroxyeicosatetraenoic acid,12-HETE ELISA Kit

201-12-1902 96 tests
EUR 440
  • This 20-hydroxyeicosatetraenoic acid ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

99445-12 DCT 12 X 75MM

99445-12 250/pk
EUR 67
Description: Disposable Culture Tubes; DCT's, CGW

Human A kinase PRKA anchor protein-gravin 12,Akap12 ELISA Kit

201-12-0668 96 tests
EUR 440
  • This A kinase PRKA anchor protein-gravin 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human heat-labile enterotoxin B subunit,LTB ELISA Kit

201-12-1817 96 tests
EUR 440
  • This heat-labile enterotoxin B subunit ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human A Disintegrin And Metalloprotease 12 (ADAM12)ELISA Kit

201-12-2811 96 tests
EUR 440
  • This A Disintegrin And Metalloprotease 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

HRSP12 antibody

70R-17814 50 ul
EUR 435
Description: Rabbit polyclonal HRSP12 antibody

HRSP12 Antibody

39509-100ul 100ul
EUR 390

HRSP12 Antibody

DF13072 200ul
EUR 304
Description: HRSP12 Antibody detects endogenous levels of HRSP12.

HRSP12 antibody

70R-4592 50 ug
EUR 467
Description: Rabbit polyclonal HRSP12 antibody raised against the N terminal of HRSP12

HRSP12 Antibody

1-CSB-PA010744GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HRSP12. Recognizes HRSP12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HRSP12 Antibody

1-CSB-PA010744LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HRSP12. Recognizes HRSP12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

HRSP12 siRNA

20-abx902535
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HRSP12 siRNA

20-abx919863
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HRSP12 siRNA

20-abx919864
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-HRSP12

YF-PA16831 50 ul
EUR 363
Description: Mouse polyclonal to HRSP12

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Mouse Ribonuclease UK114, Hrsp12 ELISA KIT

ELI-17714m 96 Tests
EUR 865

Bovine Ribonuclease UK114, HRSP12 ELISA KIT

ELI-44739b 96 Tests
EUR 928

HRSP12 protein (His tag)

80R-1597 100 ug
EUR 305
Description: Purified recombinant Human HRSP12 protein

HRSP12 Recombinant Protein (Rat)

RP205094 100 ug Ask for price

HRSP12 Recombinant Protein (Mouse)

RP142403 100 ug Ask for price

Hrsp12 ELISA Kit| Rat Ribonuclease UK114 ELISA Kit

EF018796 96 Tests
EUR 689

Hrsp12 ELISA Kit| Mouse Ribonuclease UK114 ELISA Kit

EF015143 96 Tests
EUR 689

HRSP12 ELISA Kit| Bovine Ribonuclease UK114 ELISA Kit

EF011475 96 Tests
EUR 689

Human Ribonuclease UK114 (HRSP12)

1-CSB-EP010744HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ribonuclease UK114(HRSP12) expressed in E.coli

Human HRSP12 shRNA Plasmid

20-abx956934
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Thyroid Hormone Responsive ELISA Kit

ELA-E9839h 96 Tests
EUR 824

human eosinophil-associated ribonuclease A family member 12,EAR12 ELISA KIT

201-12-0954 96 tests
EUR 440
  • This eosinophil-associated ribonuclease A family member 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human DnaJ/HSP40 Homolog Subfamily C, Member 12 (DNAJC12)ELISA kit

201-12-3247 96 tests
EUR 440
  • This DnaJ/HSP40 Homolog Subfamily C ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Individual Reaction Mix 12

G065-12 200 reactions
EUR 167

Human Scrapie responsive protein 1 (SCRG1) ELISA Kit

abx257277-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human SCRG1(Scrapie responsive protein 1) ELISA Kit

EH4143 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O75711
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Scrapie- responsive protein 1, SCRG1 ELISA KIT

ELI-13419h 96 Tests
EUR 824

HRSP12 Polyclonal Antibody

30558-100ul 100ul
EUR 252

HRSP12 Polyclonal Antibody

30558-50ul 50ul
EUR 187

HRSP12 Blocking Peptide

33R-6500 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HRSP12 antibody, catalog no. 70R-4592

HRSP12 Blocking Peptide

DF13072-BP 1mg
EUR 195

HRSP12 cloning plasmid

CSB-CL010744HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 414
  • Sequence: atgtcgtccttgatcagaagggtgatcagcaccgcgaaagccccaggggccattggaccctacagtcaagctgtattagtcgacaggaccatttacatttcaggacagataggcatggacccttcaagtggacagcttgtgtcaggaggggtagcagaagaagctaaacaagctct
  • Show more
Description: A cloning plasmid for the HRSP12 gene.

HRSP12 Rabbit pAb

A4392-100ul 100 ul
EUR 308

HRSP12 Rabbit pAb

A4392-200ul 200 ul
EUR 459

HRSP12 Rabbit pAb

A4392-20ul 20 ul
EUR 183

HRSP12 Rabbit pAb

A4392-50ul 50 ul
EUR 223

HRSP12 Polyclonal Antibody

A62750 100 µg
EUR 570.55
Description: The best epigenetics products

anti- HRSP12 antibody

FNab04014 100µg
EUR 505.25
  • Immunogen: heat-responsive protein 12
  • Uniprot ID: P52758
  • Gene ID: 10247
  • Research Area: Metabolism
Description: Antibody raised against HRSP12

Anti-HRSP12 antibody

PAab04014 100 ug
EUR 355

Anti-HRSP12 antibody

STJ24082 100 µl
EUR 277

Anti-HRSP12 (2B8)

YF-MA17215 100 ug
EUR 363
Description: Mouse monoclonal to HRSP12

Human 12-lipoxygenase,LOX-12 ELISA kit

E01L0311-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human 12-lipoxygenase,LOX-12 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 12-lipoxygenase,LOX-12 ELISA kit

E01L0311-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human 12-lipoxygenase,LOX-12 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 12-lipoxygenase,LOX-12 ELISA kit

E01L0311-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human 12-lipoxygenase,LOX-12 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin 12 (Syntaxin 12) ELISA Kit

abx259865-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human IL-12(Interleukin 12) ELISA Kit

EH0176 96T
EUR 476.25
  • Detection range: 15.625-1000 pg/ml
  • Alias: Interleukin 12 p70/CLMF p35/Cytotoxic lymphocyte maturation factor 35 kDa subunit/IL-12 subunit p35/IL-12, subunit p35/interleukin 12, p35
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Caspase 12,Casp-12 ELISA Kit

CN-03708H1 96T
EUR 486

Human Caspase 12,Casp-12 ELISA Kit

CN-03708H2 48T
EUR 336

Human 12-lipoxygenase(LOX-12)ELISA Kit

GA-E0965HM-48T 48T
EUR 289

Human 12-lipoxygenase(LOX-12)ELISA Kit

GA-E0965HM-96T 96T
EUR 466

Human Interleukin-12 (IL-12) ELISA Kit

LF-EK60032 1×96T
EUR 790

Human 12-lipoxygenase(LOX-12)ELISA Kit

QY-E05264 96T
EUR 361

Human HRSP12(Heat Responsive Protein 12) ELISA Kit