Human HPCAL1(Hippocalcin Like Protein 1) ELISA Kit

Human HPCAL1(Hippocalcin Like Protein 1) ELISA Kit

Human Hippocalcin- like protein 1, HPCAL1 ELISA KIT

ELI-30920h 96 Tests
EUR 824

Human Hippocalcin Like Protein 1 (HPCAL1) ELISA Kit

SEC533Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hippocalcin Like Protein 1 (HPCAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hippocalcin Like Protein 1 (HPCAL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Hippocalcin Like Protein 1 (HPCAL1) ELISA Kit

SEC533Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hippocalcin Like Protein 1 (HPCAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hippocalcin Like Protein 1 (HPCAL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Hippocalcin Like Protein 1 (HPCAL1) ELISA Kit

SEC533Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hippocalcin Like Protein 1 (HPCAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hippocalcin Like Protein 1 (HPCAL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Hippocalcin Like Protein 1 (HPCAL1) ELISA Kit

SEC533Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hippocalcin Like Protein 1 (HPCAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hippocalcin Like Protein 1 (HPCAL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Hippocalcin Like Protein 1 (HPCAL1) ELISA Kit

4-SEC533Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hippocalcin Like Protein 1 elisa. Alternative names of the recognized antigen: HLP2
  • BDR1
  • VILIP3
  • Visinin-Like Protein 3
  • Calcium-Binding Protein BDR-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Hippocalcin Like Protein 1 (HPCAL1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Hippocalcin Like Protein 1 (HPCAL1) Antibody

20-abx135937
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hippocalcin Like Protein 1 (HPCAL1) Antibody

abx145980-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Hippocalcin Like Protein 1 (HPCAL1) Antibody

20-abx301289
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat Hippocalcin like protein 1(HPCAL1) ELISA kit

E02H1374-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hippocalcin like protein 1(HPCAL1) ELISA kit

E02H1374-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hippocalcin like protein 1(HPCAL1) ELISA kit

E02H1374-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Hippocalcin like protein 1(HPCAL1) ELISA kit

E03H1374-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Hippocalcin like protein 1(HPCAL1) ELISA kit

E03H1374-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Hippocalcin like protein 1(HPCAL1) ELISA kit

E03H1374-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Hippocalcin like protein 1(HPCAL1) ELISA kit

E04H1374-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Hippocalcin like protein 1(HPCAL1) ELISA kit

E04H1374-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Hippocalcin like protein 1(HPCAL1) ELISA kit

E04H1374-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Hippocalcin like protein 1(HPCAL1) ELISA kit

E06H1374-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Hippocalcin like protein 1(HPCAL1) ELISA kit

E06H1374-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Hippocalcin like protein 1(HPCAL1) ELISA kit

E06H1374-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Hippocalcin like protein 1(HPCAL1) ELISA kit

E09H1374-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Hippocalcin like protein 1(HPCAL1) ELISA kit

E09H1374-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Hippocalcin like protein 1(HPCAL1) ELISA kit

E09H1374-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Hippocalcin like protein 1(HPCAL1) ELISA kit

E08H1374-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Hippocalcin like protein 1(HPCAL1) ELISA kit

E08H1374-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Hippocalcin like protein 1(HPCAL1) ELISA kit

E08H1374-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Porcine Hippocalcin- like protein 1, HPCAL1 ELISA KIT

ELI-30921p 96 Tests
EUR 928

Mouse Hippocalcin- like protein 1, Hpcal1 ELISA KIT

ELI-07977m 96 Tests
EUR 865

Pig Hippocalcin like protein 1(HPCAL1) ELISA kit

E07H1374-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Hippocalcin like protein 1(HPCAL1) ELISA kit

E07H1374-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Hippocalcin like protein 1(HPCAL1) ELISA kit

E07H1374-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Hippocalcin- like protein 1, HPCAL1 ELISA KIT

ELI-38635b 96 Tests
EUR 928

Chicken Hippocalcin- like protein 1, HPCAL1 ELISA KIT

ELI-38636c 96 Tests
EUR 928

HPCAL1 Hippocalcin-Like 1 Human Recombinant Protein

PROTP37235 Regular: 10ug
EUR 317
Description: HPCAL1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 213amino acids (1-193a.a.) and having a molecular wieght of 24.4kDa. The HPCAL1 is fused to 20a.a. His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Human Hippocalcin Like Protein 1 (HPCAL1) CLIA Kit

20-abx493748
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human HPCAL1 (Hippocalcin Like Protein 1)

ELK5245 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hippocalcin Like Protein 1 (HPCAL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
  • Show more
Description: A sandwich ELISA kit for detection of Hippocalcin Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Hippocalcin Like Protein 1 (HPCAL1) Antibody (HRP)

20-abx305432
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hippocalcin Like Protein 1 (HPCAL1) Antibody (FITC)

20-abx305433
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hippocalcin Like Protein 1 (HPCAL1) Antibody (Biotin)

20-abx305434
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guinea pig Hippocalcin like protein 1(HPCAL1) ELISA kit

E05H1374-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Hippocalcin like protein 1(HPCAL1) ELISA kit

E05H1374-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Hippocalcin like protein 1(HPCAL1) ELISA kit

E05H1374-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Hippocalcin like protein 1(HPCAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Human Hippocalcin-Like Protein 1/HPCAL1 (N-6His)

C232-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 200mM NaCl, 1mM DTT, 10% Glycerol, pH 8.0.

Recombinant Human Hippocalcin-Like Protein 1/HPCAL1 (N-6His)

C232-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 200mM NaCl, 1mM DTT, 10% Glycerol, pH 8.0.

Recombinant Human Hippocalcin-Like Protein 1/HPCAL1 (N-6His)

C232-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 200mM NaCl, 1mM DTT, 10% Glycerol, pH 8.0.

Recombinant Human Hippocalcin-Like Protein 1/HPCAL1 (N-6His)

C232-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 200mM NaCl, 1mM DTT, 10% Glycerol, pH 8.0.

Hippocalcin-Like 1 Protein

20-abx262829
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Recombinant Human Hippocalcin-Like 1

7-05377 2µg Ask for price

Recombinant Human Hippocalcin-Like 1

7-05378 10µg Ask for price

Recombinant Human Hippocalcin-Like 1

7-05379 1mg Ask for price

Human Hippocalcin- like protein 4, HPCAL4 ELISA KIT

ELI-13079h 96 Tests
EUR 824

Human Hippocalcin-Like Protein 4 (HPCAL4) ELISA Kit

abx387869-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Hpcal1/ Rat Hpcal1 ELISA Kit

ELI-31480r 96 Tests
EUR 886

Bovine Hippocalcin- like protein 4, HPCAL4 ELISA KIT

ELI-20345b 96 Tests
EUR 928

Mouse Hippocalcin- like protein 4, Hpcal4 ELISA KIT

ELI-30922m 96 Tests
EUR 865

Hippocalcin-Like Protein 4 (HPCAL4) Antibody

20-abx113015
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hippocalcin-Like Protein 4 (HPCAL4) Antibody

abx036722-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Hippocalcin-Like Protein 4 (HPCAL4) Antibody

20-abx318686
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hippocalcin-Like Protein 4 (HPCAL4) Antibody

abx233992-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Hippocalcin Like Protein 4 (HPCAL4)

4-RPF481Hu01
  • EUR 395.68
  • EUR 209.00
  • EUR 1208.80
  • EUR 469.60
  • EUR 839.20
  • EUR 328.00
  • EUR 2872.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UM19
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.8kDa
  • Isoelectric Point: 4.8
Description: Recombinant Human Hippocalcin Like Protein 4 expressed in: E.coli

Human Hippocalcin (HPCA) ELISA Kit

abx385008-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Hippocalcin(HPCA)ELISA Kit

QY-E04875 96T
EUR 361

HPCAL1 ELISA Kit (Human) (OKCD08177)

OKCD08177 96 Wells
EUR 975
Description: Description of target: Recombinant Human Hippocalcin-Like 1;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

Hippocalcin-Like Protein 4 (HPCAL4) Antibody (HRP)

20-abx312222
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hippocalcin-Like Protein 4 (HPCAL4) Antibody (FITC)

20-abx312223
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hippocalcin-Like Protein 4 (HPCAL4) Antibody (Biotin)

20-abx312224
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Hippocalcin (HPCA) Protein

20-abx650975
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

HPCAL1 Recombinant Protein (Human)

RP015187 100 ug Ask for price

Rat Hippocalcin (HPCA) ELISA Kit

abx391454-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Hippocalcin (HPCA) ELISA Kit

abx389548-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit

EI1001-1 96 Well Plate
EUR 477

anti-Hippocalcin

YF-PA12416 50 ug
EUR 363
Description: Mouse polyclonal to Hippocalcin

VSNL1 Visinin-Like Protein-1 Human Recombinant Protein

PROTP62760-1 Regular: 50ug
EUR 317
Description: VSNL1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 191 amino acids (1-191 a.a.) and having a molecular mass of 22.1kDa.;The VSNL1 is purified by proprietary chromatographic techniques.

HPCAL1 antibody

31876-100ul 100ul
EUR 252

HPCAL1 antibody

31876-50ul 50ul
EUR 187

HPCAL1 Antibody

1-CSB-PA02269A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPCAL1. Recognizes HPCAL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

HPCAL1 siRNA

20-abx902515
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HPCAL1 siRNA

20-abx919802
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HPCAL1 siRNA

20-abx919803
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

HPCAL1 protein (His tag)

80R-1478 50 ug
EUR 397
Description: Purified recombinant Human HPCAL1 protein

HPCAL1 Recombinant Protein (Rat)

RP205004 100 ug Ask for price

HPCAL1 Recombinant Protein (Mouse)

RP142286 100 ug Ask for price

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human Neuron specific calcium binding protein hippocalcin(HPCA) ELISA kit

E01N0527-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Neuron specific calcium binding protein hippocalcin(HPCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Neuron specific calcium binding protein hippocalcin(HPCA) ELISA kit

E01N0527-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Neuron specific calcium binding protein hippocalcin(HPCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Neuron specific calcium binding protein hippocalcin(HPCA) ELISA kit

E01N0527-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Neuron specific calcium binding protein hippocalcin(HPCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

DLK1 Human, Delta-Like 1 Human Recombinant Protein, HEK

PROTP80370-1 Regular: 10ug
EUR 317
Description: DLK1 Human Recombinant produced in HEK293 Cells is a single, glycosylated, polypeptide chain (a.a 24-303) containing 290 amino acids including a 10 a.a C-terminal His tag. The total molecular mass is 31.2kDa (calculated). 

FSTL1 Human, Follistatin Like 1 Human Recombinant Protein, HEK

PROTQ12841-1 Regular: 10ug
EUR 317
Description: FSTL1 Human Recombinant produced in HEK293 cells is a single, glycosylated polypeptide chain (a.a 21-308) containing 296 amino acids including a 8 a.a C-terminal His tag. The total molecular mass is 33.8kDa (calculated).

IL1RL1 Human, Interleukin-1 Receptor Like-1 Human Recombinant Protein, Sf9

PROTQ01638-1 Regular: 10ug
EUR 317
Description: IL 1RL1 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (19-328 a.a.) and fused to an 8 aa His Tag at C-terminus containing a total of 318 amino acids and having a molecular mass of 36.0kDa.;IL 1RL1 shows multiple bands between 40-57kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques.

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Mouse Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit

EMI1001-1 96 Well Plate
EUR 477

Human HPCAL1 shRNA Plasmid

20-abx952225
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Hippocalcin (HPCA) Antibody

20-abx113014
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hippocalcin (HPCA) Antibody

abx028512-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Hippocalcin (HPCA) Antibody

abx028512-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Recombinant Hippocalcin (HPCA)

4-RPF482Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P84074
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.0kDa
  • Isoelectric Point: 4.9
Description: Recombinant Human Hippocalcin expressed in: E.coli

GLP-1 Glucagon Like Peptide-1 (31 a.a.) Human Recombinant Protein

PROTP01275-1 Regular: 50ug
EUR 317
Description: Glucagon Like Peptide-1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 31 amino acids and having a molecular mass of 3298.7 Dalton. The GLP-1 is purified by proprietary chromatographic techniques.

HPCAL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0985502 1.0 ug DNA
EUR 154

[One Step] HPCAL1 Antibody Kit

RK05656 50 ul
EUR 240

TINAGL1 Human, Tubulointerstitial Nephritis Antigen Like 1 Human Recombinant Protein, Sf9

PROTQ9GZM7-1 Regular: 5ug
EUR 317
Description: TINAGL1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 455 amino acids (22-467a.a.) and having a molecular mass of 51.2kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). TINAGL1 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

HPCAL1 Polyclonal Antibody

27256-100ul 100ul
EUR 252

HPCAL1 Polyclonal Antibody

27256-50ul 50ul
EUR 187

HPCAL1 Rabbit pAb

A10019-100ul 100 ul
EUR 308

HPCAL1 Rabbit pAb

A10019-200ul 200 ul
EUR 459

HPCAL1 Rabbit pAb

A10019-20ul 20 ul
EUR 183

HPCAL1 Rabbit pAb

A10019-50ul 50 ul
EUR 223

HPCAL1 cloning plasmid

CSB-CL010695HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 582
  • Sequence: atgggcaaacagaacagcaagctgcggcccgaggtgctgcaggacctgcgggagaacacggagttcaccgaccacgagctgcaggagtggtacaagggcttcctcaaggactgccccaccggccacctgaccgtggacgagttcaagaagatctacgccaacttcttcccctacgg
  • Show more
Description: A cloning plasmid for the HPCAL1 gene.

HPCAL1 Polyclonal Antibody

A59418 100 µg
EUR 570.55
Description: Ask the seller for details

pCMV-SPORT6-HPCAL1

PVT13922 2 ug
EUR 391

Anti-HPCAL1 antibody

STJ11100840 100 µl
EUR 413
Description: The protein encoded by this gene is a member of neuron-specific calcium-binding proteins family found in the retina and brain. It is highly similar to human hippocalcin protein and nearly identical to the rat and mouse hippocalcin like-1 proteins. It may be involved in the calcium-dependent regulation of rhodopsin phosphorylation and may be of relevance for neuronal signalling in the central nervous system. Several alternatively spliced transcript variants encoding the same protein have been found for this gene.

Anti-HPCAL1 antibody

STJ112059 100 µl
EUR 277
Description: The protein encoded by this gene is a member of neuron-specific calcium-binding proteins family found in the retina and brain. It is highly similar to human hippocalcin protein and nearly identical to the rat and mouse hippocalcin like-1 proteins. It may be involved in the calcium-dependent regulation of rhodopsin phosphorylation and may be of relevance for neuronal signalling in the central nervous system. Several alternatively spliced transcript variants encoding the same protein have been found for this gene.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Anti-Vangl1/Vang Like Protein 1 Antibody

A07587-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Vangl1 Antibody (VANGL1) detection. Tested with WB in Human, Mouse.

Anti-Visinin-like Protein 1 Monoclonal Antibody

M06959-1 100ul
EUR 397
Description: Mouse Monoclonal Visinin-like Protein 1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Human HPCAL1(Hippocalcin Like Protein 1) ELISA Kit