Human GALK1(Galactokinase 1) ELISA Kit

Human GALK1(Galactokinase 1) ELISA Kit

Human Galactokinase 1 (GALK1) ELISA Kit

SEJ070Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Galactokinase 1 (GALK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Galactokinase 1 (GALK1) in tissue homogenates, cell lysates and other biological fluids.

Human Galactokinase 1 (GALK1) ELISA Kit

4-SEJ070Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Galactokinase 1 elisa. Alternative names of the recognized antigen: GALK
  • Galactose kinase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Galactokinase 1 (GALK1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human GALK1(Galactokinase) ELISA Kit

EH8671 96T
EUR 567.6
  • Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Galactokinase, GALK1 ELISA KIT

ELI-27198h 96 Tests
EUR 824

Galactokinase 1 (GALK1) Antibody

20-abx123746
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Galactokinase 1 (GALK1) Antibody

20-abx112653
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Galactokinase 1 (GALK1) Antibody

abx145833-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Galactokinase 1 (GALK1) Antibody

abx033163-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Galactokinase 1 (GALK1) Antibody

abx033163-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Galactokinase 1 (GALK1) Antibody

20-abx013515
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Galactokinase 1 (GALK1) Antibody

20-abx329292
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Galactokinase 1 (GALK1) Antibody

abx332773-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Galactokinase 1 (GALK1) Antibody

20-abx302520
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Galactokinase 1 (GALK1) Antibody

20-abx213321
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Galactokinase 1 (GALK1) Antibody

abx233319-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Mouse Galactokinase 1 (GALK1) ELISA Kit

abx389375-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Human GALK1 (Galactokinase 1)

ELK5233 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Galactokinase 1 (GALK1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Galactokin
  • Show more
Description: A sandwich ELISA kit for detection of Galactokinase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Galactokinase 1 (GALK1) CLIA Kit

20-abx495604
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Bovine Galactokinase, GALK1 ELISA KIT

ELI-30794b 96 Tests
EUR 928

Mouse Galactokinase, Galk1 ELISA KIT

ELI-30944m 96 Tests
EUR 865

Galactokinase 1 (GALK1) Antibody (HRP)

20-abx316887
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Galactokinase 1 (GALK1) Antibody (FITC)

20-abx316888
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Galactokinase 1 (GALK1) Antibody (Biotin)

20-abx316889
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GALK1 Galactokinase 1 Human Recombinant Protein

PROTP51570 Regular: 20ug
EUR 317
Description: GALK1 Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 412 amino acids (1-392 a.a.) and having a molecular mass of 44.4 kDa. The GALK1 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Galk1 ELISA Kit| Mouse Galactokinase ELISA Kit

EF015008 96 Tests
EUR 689

GALK1 ELISA Kit| Bovine Galactokinase ELISA Kit

EF011415 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

GALK1 ELISA KIT|Human

EF009759 96 Tests
EUR 689

Recombinant Human Galactokinase 1

7-04000 5µg Ask for price

Recombinant Human Galactokinase 1

7-04001 20µg Ask for price

Recombinant Human Galactokinase 1

7-04002 1mg Ask for price

Human Galactokinase 2 (GALK2) ELISA Kit

abx387481-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Galactokinase 2(GALK2)ELISA Kit

QY-E04197 96T
EUR 361

GALK1 ELISA Kit (Human) (OKCD09141)

OKCD09141 96 Wells
EUR 975
Description: Description of target: Recombinant Human Galactokinase 1;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 2.45ng/mL

GALK1 Cell ELISA Kit

abx595767-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Canine GALK1 ELISA KIT

ELI-07826d 96 Tests
EUR 928

Galactokinase 1 Protein (Recombinant)

20-abx073596
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Mouse Galactokinase 2 (GALK2) ELISA Kit

abx389376-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Galactokinase 2 (GALK2) ELISA Kit

abx391370-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human GALK1 Antibody

33076-05111 150 ug
EUR 261

GALK1 Antibody

AF0367 200ul
EUR 304
Description: GALK1 antibody detects endogenous levels of total GALK1.

GALK1 Antibody

ABF0367 100 ug
EUR 438

GALK1 siRNA

20-abx917510
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GALK1 siRNA

20-abx917511
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GALK1 antibody

70R-31747 100 ug
EUR 327
Description: Rabbit polyclonal GALK1 antibody

GALK1 Antibody

ABD3197 100 ug
EUR 438

GALK1 Antibody

33795-100ul 100ul
EUR 252

GALK1 Antibody

33795-50ul 50ul
EUR 187

GALK1 antibody

70R-17409 50 ul
EUR 435
Description: Rabbit polyclonal GALK1 antibody

GALK1 antibody

70R-10394 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GALK1 antibody

GALK1 Antibody

DF3197 200ul
EUR 304
Description: GALK1 Antibody detects endogenous levels of total GALK1.

GALK1 Antibody

1-CSB-PA002637
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GALK1. Recognizes GALK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

GALK1 Antibody

CSB-PA590136-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GALK1. Recognizes GALK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GALK1 Antibody

CSB-PA590136-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GALK1. Recognizes GALK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GALK1 Antibody

1-CSB-PA009198GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GALK1. Recognizes GALK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GALK1 Antibody

1-CSB-PA009198LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALK1. Recognizes GALK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

GALK1 Antibody

1-CSB-PA073623
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GALK1. Recognizes GALK1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

anti-GALK1

YF-PA23755 50 ul
EUR 334
Description: Mouse polyclonal to GALK1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human GALK1 shRNA Plasmid

20-abx951720
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GALK1 Recombinant Protein (Human)

RP012847 100 ug Ask for price

Galactokinase 2 (GALK2) Antibody

20-abx112654
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Galactokinase 2 (GALK2) Antibody

20-abx002821
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Galactokinase 2 (GALK2) Antibody

abx036207-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Galactokinase 2 (GALK2) Antibody

abx033164-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Galactokinase 2 (GALK2) Antibody

abx033164-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Galactokinase 2 (GALK2) Antibody

abx033165-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Galactokinase 2 (GALK2) Antibody

abx033165-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Galactokinase 2 (GALK2) Antibody

20-abx303931
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Galactokinase 2 (GALK2) Antibody

abx233320-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

GALK1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0834702 1.0 ug DNA
EUR 154

GALK1 Colorimetric Cell-Based ELISA Kit (OKAG01257)

OKAG01257 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:

GALK1 Colorimetric Cell-Based ELISA

EKC1735 100ul
EUR 572

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

GALK1 Conjugated Antibody

C33795 100ul
EUR 397

GALK1 Blocking Peptide

AF0367-BP 1mg
EUR 195

GALK1 cloning plasmid

CSB-CL009198HU-10ug 10ug
EUR 440
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1179
  • Sequence: atggctgctttgagacagccccaggtcgcggagctgctggccgaggcccggcgagccttccgggaggagttcggggccgagcccgagctggccgtgtcagcgccgggccgcgtcaacctcatcggggaacacacggactacaaccagggcctggtgctgcctatggctctggagc
  • Show more
Description: A cloning plasmid for the GALK1 gene.

GALK1 Polyclonal Antibody

ES2396-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GALK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

GALK1 Polyclonal Antibody

ES2396-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GALK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

anti- GALK1 antibody

FNab03319 100µg
EUR 505.25
  • Immunogen: galactokinase 1
  • Uniprot ID: P51570
  • Gene ID: 2584
  • Research Area: Metabolism
Description: Antibody raised against GALK1

GALK1 Polyclonal Antibody

ABP51397-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human GALK1 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of GALK1 from Human, Mouse, Rat. This GALK1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human GALK1 at AA range: 1-80

GALK1 Polyclonal Antibody

ABP51397-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human GALK1 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of GALK1 from Human, Mouse, Rat. This GALK1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human GALK1 at AA range: 1-80

GALK1 Polyclonal Antibody

ABP51397-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human GALK1 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of GALK1 from Human, Mouse, Rat. This GALK1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human GALK1 at AA range: 1-80

Anti-GALK1 Antibody

A06627 100ul
EUR 397
Description: Rabbit Polyclonal GALK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

GALK1 Rabbit pAb

A15274-100ul 100 ul
EUR 308

GALK1 Rabbit pAb

A15274-200ul 200 ul
EUR 459

GALK1 Rabbit pAb

A15274-20ul 20 ul
EUR 183

GALK1 Rabbit pAb

A15274-50ul 50 ul
EUR 223

GALK1 Rabbit pAb

A9085-100ul 100 ul
EUR 308

GALK1 Rabbit pAb

A9085-200ul 200 ul
EUR 459

GALK1 Rabbit pAb

A9085-20ul 20 ul Ask for price

GALK1 Rabbit pAb

A9085-50ul 50 ul Ask for price

GALK1 Blocking Peptide

33R-10307 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALK1 antibody, catalog no. 70R-10394

GALK1 Polyclonal Antibody

40948-100ul 100ul
EUR 252

GALK1 Polyclonal Antibody

40948-50ul 50ul
EUR 187

GALK1 Blocking Peptide

DF3197-BP 1mg
EUR 195

Anti-GALK1 antibody

PAab03319 100 ug
EUR 355

Anti-GALK1 antibody

STJ93207 200 µl
EUR 197
Description: Rabbit polyclonal to GALK1.

Anti-GALK1 antibody

STJ111557 100 µl
EUR 277
Description: Galactokinase is a major enzyme for the metabolism of galactose and its deficiency causes congenital cataracts during infancy and presenile cataracts in the adult population.

Anti-GALK1 antibody

STJ117469 100 µl
EUR 277
Description: Galactokinase is a major enzyme for the metabolism of galactose and its deficiency causes congenital cataracts during infancy and presenile cataracts in the adult population.

Anti-GALK1 (2E9)

YF-MA13179 100 ug
EUR 363
Description: Mouse monoclonal to GALK1

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Human GALK1 Antibody (Biotin Conjugate)

33076-05121 150 ug
EUR 369

Human GALK1(Galactokinase 1) ELISA Kit