Human FNTa(Farnesyltransferase Alpha) ELISA Kit

Human FNTa(Farnesyltransferase Alpha) ELISA Kit

Human Farnesyltransferase Alpha (FNTa) ELISA Kit
SEG487Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit
SEG487Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit
4-SEG487Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Farnesyltransferase Alpha elisa. Alternative names of the recognized antigen: FPTA PTAR2 PGGT1A Protein Prenyltransferase Alpha Subunit Repeat Containing 2 CAAX farnesyltransferase subunit alpha Ras proteins prenyltransferase subun Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Farnesyltransferase Alpha (FNTa) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Farnesyltransferase Alpha (FNTA) Antibody
20-abx112466	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody
20-abx123732	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTa) Antibody
20-abx128216	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Farnesyltransferase Alpha (FNTa) Antibody
20-abx172331	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Farnesyltransferase Alpha (FNTA) Antibody
abx031598-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody
abx031598-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody
abx031599-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody
abx031599-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody
abx233180-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Farnesyltransferase Alpha (FNTa)
4-RPG487Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P49354 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 41.7KDa Isoelectric Point: Inquire
Description: Recombinant Human Farnesyltransferase Alpha expressed in: E.coli

Human Farnesyltransferase Alpha (FNTa) Protein
20-abx166599	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Farnesyltransferase alpha (FNTa) CLIA Kit
20-abx495216	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human FNTa (Farnesyltransferase Alpha)
ELK4902	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Farnesyltransferase Alpha (FNT?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to F Show more
Description: A sandwich ELISA kit for detection of Farnesyltransferase Alpha from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse)
4-PAG487Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa)

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), APC
4-PAG487Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with APC.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAG487Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with Biotin.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), Cy3
4-PAG487Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with Cy3.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), FITC
4-PAG487Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with FITC.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), HRP
4-PAG487Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with HRP.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), PE
4-PAG487Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with PE.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAG487Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with APC-Cy7.

Fnta/ Rat Fnta ELISA Kit
ELI-47317r	Lifescience Market	96 Tests	EUR 886

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human FNTA ELISA KIT
ELI-26701h	Lifescience Market	96 Tests	EUR 824

FNTA ELISA KIT|Human
EF009665	Lifescience Market	96 Tests	EUR 689

FNTA ELISA Kit (Human) (OKCD00703)
OKCD00703	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Essential subunit of both the farnesyltransferase and the geranylgeranyltransferase complex. Contributes to the transfer of a farnesyl or geranylgeranyl moiety from farnesyl or geranylgeranyl diphosphate to a cysteine at the fourth position from the C-terminus of several proteins having the C-terminal sequence Cys-aliphatic-aliphatic-X. May positively regulate neuromuscular junction development downstream of MUSK via its function in RAC1 prenylation and activation.6 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.2"Mutational analysis of alpha-subunit of protein farnesyltransferase. Evidence for a catalytic role."_x005F_x005F_x000D_Andres D.A., Goldstein J.L., Ho Y.K., Brown M.S._x005F_x005F_x000D_J. Biol. Chem. 268:1383-1390(1993) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), MUTAGENESIS OF LYS-164, FUNCTION, CATALYTIC ACTIVITY, SUBUNIT.Ref.3"Characterization of recombinant human farnesyl-protein transferase: cloning, expression, farnesyl diphosphate binding, and functional homology with yeast prenyl-protein transferases."_x005F_x005F_x000D_Omer C.A., Kral A.M., Diehl R.E., Prendergast G.C., Powers S., Allen C.M., Gibbs J.B., Kohl N.E._x005F_x005F_x000D_Biochemistry 32:5167-5176(1993) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), MUTAGENESIS OF ASN-199, CATALYTIC ACTIVITY, FUNCTION.Ref.16"3-aminopyrrolidinone farnesyltransferase inhibitors: design of macrocyclic compounds with improved pharmacokinetics and excellent cell potency."_x005F_x005F_x000D_Bell I.M., Gallicchio S.N., Abrams M., Beese L.S., Beshore D.C., Bhimnathwala H., Bogusky M.J., Buser C.A., Culberson J.C., Davide J., Ellis-Hutchings M., Fernandes C., Gibbs J.B., Graham S.L., Hamilton K.A., Hartman G.D., Heimbrook D.C., Homnick C.F. , Huber H.E., Huff J.R., Kassahun K., Koblan K.S., Kohl N.E., Lobell R.B., Lynch J.J. Jr., Robinson R., Rodrigues A.D., Taylor J.S., Walsh E.S., Williams T.M., Zartman C.B._x005F_x005F_x000D_J. Med. Chem. 45:2388-2409(2002) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.0 ANGSTROMS) IN COMPLEX WITH FNTB, SUBUNIT, FUNCTION, CATALYTIC ACTIVITY.Ref.17"Dual protein farnesyltransferase-geranylgeranyltransferase-I inhibitors as potential cancer chemotherapeutic agents."_x005F_x005F_x000D_deSolms S.J., Ciccarone T.M., MacTough S.C., Shaw A.W., Buser C.A., Ellis-Hutchings M., Fernandes C., Hamilton K.A., Huber H.E., Kohl N.E., Lobell R.B., Robinson R.G., Tsou N.N., Walsh E.S., Graham S.L., Beese L.S., Taylor J.S._x005F_x005F_x000D_J. Med. Chem. 46:2973-2984(2003) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.0 ANGSTROMS) IN COMPLEX WITH FNTB, SUBUNIT, FUNCTION, CATALYTIC ACTIVITY.Ref.20"Conversion of protein farnesyltransferase to a geranylgeranyltransferase."_x005F_x005F_x000D_Terry K.L., Casey P.J., Beese L.S._x005F_x005F_x000D_Biochemistry 45:9746-9755(2006) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.50 ANGSTROMS) IN COMPLEX WITH FNTB, FUNCTION, SUBUNIT, CATALYTIC ACTIVITY.Ref.21"Structural basis for binding and selectivity of antimalarial and anticancer ethylenediamine inhibitors to protein farnesyltransferase."_x005F_x005F_x000D_Hast M.A., Fletcher S., Cummings C.G., Pusateri E.E., Blaskovich M.A., Rivas K., Gelb M.H., Van Voorhis W.C., Sebti S.M., Hamilton A.D., Beese L.S._x005F_x005F_x000D_Chem. Biol. 16:181-192(2009) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.80 ANGSTROMS) OF 1-379 IN COMPLEX WITH FNTB, SUBUNIT, FUNCTION, CATALYTIC ACTIVITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.56 ng/mL

Bovine FNTA ELISA KIT
ELI-07852b	Lifescience Market	96 Tests	EUR 928

Mouse Fnta ELISA KIT
ELI-07853m	Lifescience Market	96 Tests	EUR 865

Human Farnesyltransferase Beta (FNTb) ELISA Kit
20-abx258623	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Farnesyltransferase Beta(FNTb)ELISA Kit
QY-E03677	Qayee Biotechnology	96T	EUR 361

Human Farnesyltransferase Beta (FNTb) ELISA Kit
SEJ090Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit
SEJ090Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit
SEJ090Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit
SEJ090Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit
4-SEJ090Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Farnesyltransferase Beta elisa. Alternative names of the recognized antigen: FPTB CAAX farnesyltransferase subunit beta Ras proteins prenyltransferase subunit beta
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Farnesyltransferase Beta (FNTb) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Recombinant human FNTA
P1431	FN Test	100ug	Ask for price
Uniprot ID: P49354 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human FNTA

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E01F0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E01F0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E01F0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human FNTb (Farnesyltransferase Beta)
ELK5384	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Farnesyltransferase Beta (FNTb). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fa Show more
Description: A sandwich ELISA kit for detection of Farnesyltransferase Beta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

FNTA antibody
70R-17339	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FNTA antibody

FNTA antibody
70R-1202	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal FNTA antibody raised against the C terminal of FNTA

FNTA antibody
70R-2956	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FNTA antibody raised against the N terminal of FNTA

FNTA Antibody
36174-100ul	SAB	100ul	EUR 252

FNTA Antibody
1-CSB-PA064938	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FNTA. Recognizes FNTA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

FNTA Antibody
DF8125	Affbiotech	200ul	EUR 304
Description: FNTA Antibody detects endogenous levels of total FNTA.

FNTA Antibody
20-abx241221	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

FNTA Antibody
1-CSB-PA008777GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FNTA. Recognizes FNTA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FNTA siRNA
20-abx901995	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FNTA siRNA
20-abx917055	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FNTA siRNA
20-abx917056	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FNTA Antibody
ABD8125	Lifescience Market	100 ug	EUR 438

anti-FNTA
YF-PA11835	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to FNTA

anti-FNTA
YF-PA11836	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to FNTA

anti-FNTA
YF-PA11837	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to FNTA

Human FNTA shRNA Plasmid
20-abx951638	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FNTA Recombinant Protein (Human)
RP012424	ABM	100 ug	Ask for price

FNTA Recombinant Protein (Human)
RP039253	ABM	100 ug	Ask for price

Human farnesyl-diphosphate farnesyltransferase 1,FDFT1 ELISA Kit
201-12-0752	SunredBio	96 tests	EUR 440
This farnesyl-diphosphate farnesyltransferase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx252452-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human fFDFT1(Farnesyl Diphosphate Farnesyltransferase 1) ELISA Kit
EH3056	FN Test	96T	EUR 524.1
Detection range: 1.563-100mIU/ml Alias: fFDFT1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938mU/ml

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit
GA-E0768HM-48T	GenAsia Biotech	48T	EUR 289

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit
GA-E0768HM-96T	GenAsia Biotech	96T	EUR 466

Human Protein farnesyltransferase subunit beta, FNTB ELISA KIT
ELI-32519h	Lifescience Market	96 Tests	EUR 824

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit
QY-E03679	Qayee Biotechnology	96T	EUR 361

Human Farnesyltransferase Beta (FNTb) CLIA Kit
20-abx495613	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E02F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E02F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E02F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E03F0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E03F0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E03F0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E06F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E06F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E06F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E04F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E04F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E04F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E09F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E09F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E09F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E08F0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E08F0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E08F0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E07F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E07F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E07F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FNTA Blocking Peptide
33R-2083	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FNTA antibody, catalog no. 70R-1202

FNTA Blocking Peptide
33R-5613	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FNTA antibody, catalog no. 70R-2956

FNTA Blocking Peptide
DF8125-BP	Affbiotech	1mg	EUR 195

FNTA Conjugated Antibody
C36174	SAB	100ul	EUR 397

FNTA cloning plasmid
CSB-CL008777HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 645 Sequence: atgtcctgtacagttagagatgtttatgattacttccgagctgtcctgcagcgtgatgaaagaagtgaacgagcttttaagctaacccgggatgctattgagttaaatgcagccaattatacagtgtggcatttccggagagttcttttgaagtcacttcagaaggatctacatga Show more
Description: A cloning plasmid for the FNTA gene.

FNTA cloning plasmid
CSB-CL008777HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1140 Sequence: ATGGCGGCCACCGAGGGGGTCGGGGAGGCTGCGCAAGGGGGCGAGCCCGGGCAGCCGGCGCAACCCCCGCCCCAGCCGCACCCACCGCCGCCCCAGCAGCAGCACAAGGAAGAGATGGCGGCCGAGGCTGGGGAAGCCGTGGCGTCCCCCATGGACGACGGGTTTGTGAGCCTGG Show more
Description: A cloning plasmid for the FNTA gene.

Human FNTa(Farnesyltransferase Alpha) ELISA Kit