Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit
 ELISA Kit) Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit |
|
SEJ123Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids. |
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit |
|
SEJ123Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids. |
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit |
|
SEJ123Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids. |
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit |
|
4-SEJ123Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Fumarylacetoacetate Hydrolase elisa. Alternative names of the recognized antigen: FAA
- Fumarylacetoacetase
- Tyrosinemia 1
- Beta-diketonase
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fumarylacetoacetate Hydrolase (FAH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 Antibody) Fumarylacetoacetate Hydrolase (FAH) Antibody |
|
abx026534-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Fumarylacetoacetate Hydrolase (FAH) Antibody |
|
abx026534-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Fumarylacetoacetate Hydrolase (FAH) Antibody |
|
20-abx005052 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Fumarylacetoacetate Hydrolase (FAH) Antibody |
|
abx018095-100ug |
Abbexa |
100 ug |
EUR 384 |
- Shipped within 5-10 working days.
|
Fumarylacetoacetate Hydrolase (FAH) Antibody |
|
abx018096-100ug |
Abbexa |
100 ug |
EUR 384 |
- Shipped within 5-10 working days.
|
Fumarylacetoacetate Hydrolase (FAH) Antibody |
|
20-abx102858 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Fumarylacetoacetate Hydrolase (FAH) Antibody |
|
20-abx102859 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Fumarylacetoacetate Hydrolase (FAH) Antibody |
|
20-abx112607 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fumarylacetoacetate Hydrolase (FAH) Antibody |
|
abx036126-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Fumarylacetoacetate Hydrolase (FAH) Antibody |
|
20-abx317985 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Fumarylacetoacetate Hydrolase (FAH) Antibody |
|
abx232948-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Fumarylacetoacetate Hydrolase (FAH) Antibody |
|
20-abx002320 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) Recombinant Fumarylacetoacetate Hydrolase (FAH) |
|
4-RPJ123Hu01 |
Cloud-Clone |
-
EUR 517.54
-
EUR 241.00
-
EUR 1665.76
-
EUR 621.92
-
EUR 1143.84
-
EUR 409.00
-
EUR 4014.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P16930
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 18.9kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Fumarylacetoacetate Hydrolase expressed in: E.coli |
Recombinant Fumarylacetoacetate Hydrolase (FAH) |
|
4-RPJ123Hu02 |
Cloud-Clone |
-
EUR 517.54
-
EUR 241.00
-
EUR 1665.76
-
EUR 621.92
-
EUR 1143.84
-
EUR 409.00
-
EUR 4014.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P16930
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.0kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Fumarylacetoacetate Hydrolase expressed in: E.coli |
 ELISA Kit) Mouse Fumarylacetoacetate Hydrolase (FAH) ELISA Kit |
|
20-abx389353 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
 Protein) Human Fumarylacetoacetate Hydrolase (FAH) Protein |
|
20-abx066699 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2249.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Fumarylacetoacetate Hydrolase (FAH) Protein |
|
20-abx066700 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2249.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
 CLIA Kit) Human Fumarylacetoacetate Hydrolase (FAH) CLIA Kit |
|
20-abx495621 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
) ELISA kit for Human FAH (Fumarylacetoacetate Hydrolase) |
|
ELK4894 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fumarylacetoacetate Hydrolase (FAH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
- Show more
|
|
Description: A sandwich ELISA kit for detection of Fumarylacetoacetate Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 Antibody (Biotin)) Fumarylacetoacetate Hydrolase (FAH) Antibody (Biotin) |
|
20-abx272420 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 Antibody (HRP)) Fumarylacetoacetate Hydrolase (FAH) Antibody (HRP) |
|
20-abx303802 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Fumarylacetoacetate Hydrolase (FAH) Antibody (FITC) |
|
20-abx303803 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Fumarylacetoacetate Hydrolase (FAH) Antibody (Biotin) |
|
20-abx303804 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Polyclonal Antibody (Human)) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human) |
|
4-PAJ123Hu02 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Val189~Ser419)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH) |
 Polyclonal Antibody (Human), APC) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), APC |
|
4-PAJ123Hu02-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Val189~Ser419)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), Biotinylated |
|
4-PAJ123Hu02-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Val189~Ser419)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), Cy3 |
|
4-PAJ123Hu02-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Val189~Ser419)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), FITC |
|
4-PAJ123Hu02-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Val189~Ser419)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), HRP |
|
4-PAJ123Hu02-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Val189~Ser419)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), PE |
|
4-PAJ123Hu02-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Val189~Ser419)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with PE. |
 Polyclonal Antibody (Human, Mouse, Rat)) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat) |
|
4-PAJ123Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Ile40~Leu195)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH) |
 Polyclonal Antibody (Human), APC-Cy7) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAJ123Hu02-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Val189~Ser419)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC-Cy7. |
 Polyclonal Antibody (Human, Mouse, Rat), APC) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), APC |
|
4-PAJ123Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Ile40~Leu195)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC. |
 Polyclonal Antibody (Human, Mouse, Rat), Biotinylated) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated |
|
4-PAJ123Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Ile40~Leu195)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human, Mouse, Rat), Cy3) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), Cy3 |
|
4-PAJ123Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Ile40~Leu195)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human, Mouse, Rat), FITC) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), FITC |
|
4-PAJ123Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Ile40~Leu195)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human, Mouse, Rat), HRP) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), HRP |
|
4-PAJ123Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Ile40~Leu195)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human, Mouse, Rat), PE) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), PE |
|
4-PAJ123Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Ile40~Leu195)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with PE. |
 Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7) Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7 |
|
4-PAJ123Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAH (Ile40~Leu195)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC-Cy7. |
) Anti-Fumarylacetoacetate hydrolase (3G2) |
|
YF-MA12951 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Fumarylacetoacetate hydrolase |
 Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1 |
|
7-02743 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1 |
|
7-02744 |
CHI Scientific |
20µg |
Ask for price |
Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1 |
|
7-02745 |
CHI Scientific |
1mg |
Ask for price |
) Fumarylacetoacetate Hydrolase Domain Containing 1 (Recombinant) |
|
20-abx073193 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 FAHD1 Fumarylacetoacetate Hydrolase Domain Containing 1 Human Recombinant Protein |
|
PROTQ6P587 |
BosterBio |
Regular: 20ug |
EUR 317 |
|
Description: FAHD1 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 244 amino acids (1-224 a.a.) and having a molecular mass of 27kDa. The FAHD1 is purified by proprietary chromatographic techniques. |
 Antibody) Fumarylacetoacetate Hydrolase Domain-Containing Protein 2B (FAHD2B) Antibody |
|
abx030304-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Fumarylacetoacetate Hydrolase Domain-Containing Protein 2B (FAHD2B) Antibody |
|
abx030304-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
 Antibody) Fumarylacetoacetate Hydrolase Domain-Containing Protein 2A (FAHD2A) Antibody |
|
20-abx308897 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (OKCD00555)) FAH ELISA Kit (Human) (OKCD00555) |
|
OKCD00555 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
|
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.058 ng/mL |
 Mouse Fah/ Fumarylacetoacetase ELISA Kit |
|
E0499Mo |
Sunlong |
1 Kit |
EUR 632 |
 (OKEH08226)) FAH ELISA Kit (Mouse) (OKEH08226) |
|
OKEH08226 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
|
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.048ng/mL |
 Fah ELISA Kit| Mouse Fumarylacetoacetase ELISA Kit |
|
EF014986 |
Lifescience Market |
96 Tests |
EUR 689 |
 FAH ELISA Kit| Bovine Fumarylacetoacetase ELISA Kit |
|
EF011403 |
Lifescience Market |
96 Tests |
EUR 689 |
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 FAH antibody |
|
70R-17200 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal FAH antibody |
FAH antibody |
|
70R-1062 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal FAH antibody |
FAH antibody |
|
70R-2625 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal FAH antibody |
FAH antibody |
|
39026-100ul |
SAB |
100ul |
EUR 252 |
 FAH Antibody |
|
39846-100ul |
SAB |
100ul |
EUR 390 |
FAH Antibody |
|
1-CSB-PA007965GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against FAH. Recognizes FAH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
FAH Antibody |
|
1-CSB-PA007965LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against FAH. Recognizes FAH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
 FAH siRNA |
|
20-abx901829 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FAH siRNA |
|
20-abx915946 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FAH siRNA |
|
20-abx915947 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Human FAH shRNA Plasmid |
|
20-abx951521 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) FAH Recombinant Protein (Human) |
|
RP011182 |
ABM |
100 ug |
Ask for price |
 FAH Rabbit pAb |
|
A13492-100ul |
Abclonal |
100 ul |
EUR 308 |
FAH Rabbit pAb |
|
A13492-200ul |
Abclonal |
200 ul |
EUR 459 |
FAH Rabbit pAb |
|
A13492-20ul |
Abclonal |
20 ul |
EUR 183 |
FAH Rabbit pAb |
|
A13492-50ul |
Abclonal |
50 ul |
EUR 223 |
 FAH Blocking Peptide |
|
33R-1054 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EPN1 antibody, catalog no. 70R-3618 |
FAH Blocking Peptide |
|
33R-8429 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FAH antibody, catalog no. 70R-2625 |
 FAH Conjugated Antibody |
|
C39026 |
SAB |
100ul |
EUR 397 |
 FAH cloning plasmid |
|
CSB-CL007965HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1260
- Sequence: atgtccttcatcccggtggccgaggattccgacttccccatccacaacctgccctacggcgtcttctcgaccagaggcgacccaagaccgaggataggtgtggccattggcgaccagatcctggacctcagcatcatcaagcacctctttactggtcctgtcctctccaaacacc
- Show more
|
|
Description: A cloning plasmid for the FAH gene. |
FAH Rabbit pAb |
|
A6586-100ul |
Abclonal |
100 ul |
EUR 308 |
FAH Rabbit pAb |
|
A6586-200ul |
Abclonal |
200 ul |
EUR 459 |
FAH Rabbit pAb |
|
A6586-20ul |
Abclonal |
20 ul |
EUR 183 |
FAH Rabbit pAb |
|
A6586-50ul |
Abclonal |
50 ul |
EUR 223 |
 FAH Polyclonal Antibody |
|
A62538 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
FAH Rabbit pAb |
|
A3238-100ul |
Abclonal |
100 ul |
EUR 384 |
FAH Rabbit pAb |
|
A3238-200ul |
Abclonal |
200 ul |
Ask for price |
FAH Rabbit pAb |
|
A3238-20ul |
Abclonal |
20 ul |
Ask for price |
FAH Rabbit pAb |
|
A3238-50ul |
Abclonal |
50 ul |
EUR 265 |
 anti- FAH antibody |
|
FNab02948 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: fumarylacetoacetate hydrolase (fumarylacetoacetase)
- Uniprot ID: P16930
- Gene ID: 2184
- Research Area: Metabolism
|
|
Description: Antibody raised against FAH |
 Anti-FAH antibody |
|
STJ28669 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT). |
Anti-FAH antibody |
|
STJ115453 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT). |
Anti-FAH antibody |
|
STJ23615 |
St John's Laboratory |
100 µl |
EUR 393 |
|
Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT). |
 (pORF)) FAH ORF Vector (Human) (pORF) |
|
ORF003728 |
ABM |
1.0 ug DNA |
EUR 95 |
ELISA Kit) Human Acyloxyacyl Hydrolase (AOAH)ELISA Kit |
|
201-12-2818 |
SunredBio |
96 tests |
EUR 440 |
- This Acyloxyacyl Hydrolase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 ELISA Kit) Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
DLR-AOAH-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
DLR-AOAH-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
 ELISA Kit) Human Bleomycin Hydrolase (BLMH) ELISA Kit |
|
DLR-BLMH-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Bleomycin Hydrolase (BLMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
|
DLR-BLMH-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Bleomycin Hydrolase (BLMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates or other biological fluids. |
 ELISA kit) Human Bleomycin hydrolase(BLMH) ELISA kit |
|
E01B0805-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Bleomycin hydrolase(BLMH) ELISA kit |
|
E01B0805-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Bleomycin hydrolase(BLMH) ELISA kit |
|
E01B0805-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E01A1552-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E01A1552-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E01A1552-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human γ Glutamate Hydrolase ELISA kit |
|
E01G0559-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human γ Glutamate Hydrolase ELISA kit |
|
E01G0559-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human γ Glutamate Hydrolase ELISA kit |
|
E01G0559-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit |
|
E01H0015-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit |
|
E01H0015-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit |
|
E01H0015-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
20-abx150541 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
|
20-abx150813 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 ELISA Kit) Human Hydroxyacylglutathione Hydrolase (HAGH) ELISA Kit |
|
abx252611-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Human HAGH(Hydroxyacylglutathione Hydrolase) ELISA Kit |
|
EH3210 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: Q16775
- Alias: HAGH/GLX2/HAGH/GLO2hydroxyacyl glutathione hydrolase/Glx II/GLXII/Glyoxalase II/HAGH1GLX2/hydroxyacylglutathione hydrolase/hydroxyacylglutathione hydrolase, mitochondrial/hydroxyacylglutathion
- Show more
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
 Human Valacyclovir hydrolase, BPHL ELISA KIT |
|
ELI-11153h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
CSB-EL001853HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
1-CSB-EL001853HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase(AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Bleomycin hydrolase(BLMH) ELISA kit |
|
CSB-EL002716HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase (BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Bleomycin hydrolase(BLMH) ELISA kit |
|
1-CSB-EL002716HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase(BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 ELISA Kit) Human Valacyclovir Hydrolase (BPHL) ELISA Kit |
|
20-abx386067 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
 Human Acyloxyacyl hydrolase, AOAH ELISA KIT |
|
ELI-34429h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA Kit) Human Hydroxyacylglutathione Hydrolase(HAGH)ELISA Kit |
|
QY-E01881 |
Qayee Biotechnology |
96T |
EUR 361 |
) Human Bleomycin Hydrolase ELISA Kit (BLMH) |
|
RK00979 |
Abclonal |
96 Tests |
EUR 521 |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
RDR-AOAH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
RDR-AOAH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
|
RDR-BLMH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
|
RDR-BLMH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
|
SEC220Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids. |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
|
SEC220Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids. |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
|
SEC220Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids. |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
|
SEC220Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids. |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
|
4-SEC220Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Bleomycin Hydrolase elisa. Alternative names of the recognized antigen: BH
- BMH
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
RD-AOAH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
RD-AOAH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
|
RD-BLMH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
|
RD-BLMH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
SEJ634Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
SEJ634Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
SEJ634Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
SEJ634Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
4-SEJ634Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Acyloxyacyl Hydrolase elisa. Alternative names of the recognized antigen: n/a
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
 Frit Kit |
|
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
|
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
 Column Packing Kit |
|
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
|
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
 PCR Mycoplasma Detection Kit |
|
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
 Rat FAH shRNA Plasmid |
|
20-abx985461 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 FAH Antibody, HRP conjugated |
|
1-CSB-PA007965LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against FAH. Recognizes FAH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 FAH Antibody, FITC conjugated |
|
1-CSB-PA007965LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against FAH. Recognizes FAH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 FAH Antibody, Biotin conjugated |
|
1-CSB-PA007965LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against FAH. Recognizes FAH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Mouse FAH shRNA Plasmid |
|
20-abx970277 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) FAH Recombinant Protein (Rat) |
|
RP200270 |
ABM |
100 ug |
Ask for price |
) FAH Recombinant Protein (Mouse) |
|
RP132728 |
ABM |
100 ug |
Ask for price |
) Recombinant Human Fumarylacetoacetase/FAH (C-6His) |
|
C874-10ug |
Novoprotein |
10ug |
EUR 202 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
Recombinant Human Fumarylacetoacetase/FAH (C-6His) |
|
C874-1mg |
Novoprotein |
1mg |
EUR 2283 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
Recombinant Human Fumarylacetoacetase/FAH (C-6His) |
|
C874-500ug |
Novoprotein |
500ug |
EUR 1613 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
Recombinant Human Fumarylacetoacetase/FAH (C-6His) |
|
C874-50ug |
Novoprotein |
50ug |
EUR 496 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
) FAH sgRNA CRISPR Lentivector set (Human) |
|
K0711501 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Human peptidyl-tRNA hydrolase,PTRH ELISA Kit |
|
201-12-2032 |
SunredBio |
96 tests |
EUR 440 |
- This peptidyl-tRNA hydrolase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
) ELISA kit for Human HAGH (Hydroxyacylglutathione Hydrolase) |
|
E-EL-H1078 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's HAGH ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human HAGH. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
|
Description: A sandwich ELISA kit for quantitative measurement of Human HAGH (Hydroxyacylglutathione Hydrolase) in samples from Serum, Plasma, Cell supernatant |
 ELISA Kit) Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit |
|
DLR-LTA4H-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukotriene A4 Hydrolase (LTA4H) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit |
|
DLR-LTA4H-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukotriene A4 Hydrolase (LTA4H) in samples from serum, plasma, tissue homogenates or other biological fluids. |
 ELISA Kit) Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit |
|
DLR-gGH-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Gamma-Glutamyl Hydrolase (gGH) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit |
|
DLR-gGH-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Gamma-Glutamyl Hydrolase (gGH) in samples from serum, plasma, tissue homogenates or other biological fluids. |
 ELISA kit) Human Lactase-phlorizin hydrolase(LCT) ELISA kit |
|
CSB-EL012827HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Lactase-phlorizin hydrolase (LCT) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Lactase-phlorizin hydrolase(LCT) ELISA kit |
|
1-CSB-EL012827HU |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Lactase-phlorizin hydrolase(LCT) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 ELISA kit) Human Epoxide hydrolase 1(EPHX1) ELISA kit |
|
E01E0380-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Epoxide hydrolase 1(EPHX1) ELISA kit |
|
E01E0380-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Epoxide hydrolase 1(EPHX1) ELISA kit |
|
E01E0380-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Human Epoxide hydrolase 2(EPHX2) ELISA kit |
|
E01E0381-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Epoxide hydrolase 2(EPHX2) ELISA kit |
|
E01E0381-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Epoxide hydrolase 2(EPHX2) ELISA kit |
|
E01E0381-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Human Leukotriene A4 Hydrolase (LTA4H) ELISA kit |
|
E01L0040-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 Hydrolase (LTA4H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Leukotriene A4 Hydrolase (LTA4H) ELISA kit |
|
E01L0040-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 Hydrolase (LTA4H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Leukotriene A4 Hydrolase (LTA4H) ELISA kit |
|
E01L0040-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 Hydrolase (LTA4H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA Kit) Human gamma Glutamyl Hydrolase (gGH) ELISA Kit |
|
20-abx151653 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit |
|
20-abx152241 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 ELISA Kit) Human Gamma-Glutamyl Hydrolase (GGH) ELISA Kit |
|
abx257522-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Human ADP Ribosylarginine Hydrolase (ADPRH) ELISA Kit |
|
20-abx258631 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 ELISA Kit) Human Epoxide Hydrolase 4 (EPHX4) ELISA Kit |
|
abx251403-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit |
|
abx252710-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Human LTA4H(Leukotriene A4 Hydrolase) ELISA Kit |
|
EH3307 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: P09960
- Alias: LTA4H/EC 3.3.2.6/Leukotriene A(4) hydrolase/leukotriene A4 hydrolase/leukotriene A-4 hydrolase/LTA4/LTA-4 hydrolase
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
 ELISA Kit) Human GGH(Gamma-glutamyl hydrolase) ELISA Kit |
|
EH4206 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.469-30 ng/ml
- Uniprot ID: Q92820
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.281 ng/ml |
 Human EPHX4/ Epoxide hydrolase 4 ELISA Kit |
|
E0804Hu |
Sunlong |
1 Kit |
EUR 571 |
 Human ESD/ S-formylglutathione hydrolase ELISA Kit |
|
E0819Hu |
Sunlong |
1 Kit |
EUR 605 |
 ELISA Kit) Human EPHX4(Epoxide hydrolase 4) ELISA Kit |
|
EH2072 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: Q8IUS5
- Alias: EPHX4(Epoxide hydrolase 4)/ABHD7/EPHXRP/Abhydrolase domain-containing protein 7/Epoxide hydrolase-related protein
|
|
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
 Human Putative hydrolase RBBP9, RBBP9 ELISA KIT |
|
ELI-14004h |
Lifescience Market |
96 Tests |
EUR 824 |
 Human Mitochondrial cardiolipin hydrolase, PLD6 ELISA KIT |
|
ELI-15234h |
Lifescience Market |
96 Tests |
EUR 824 |
 Human Lactase- phlorizin hydrolase, LCT ELISA KIT |
|
ELI-23573h |
Lifescience Market |
96 Tests |
EUR 824 |
) ELISA kit for Human BLMH (Bleomycin Hydrolase) |
|
ELK3153 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Bleomycin Hydrolase (BLMH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Bleomyc
- Show more
|
|
Description: A sandwich ELISA kit for detection of Bleomycin Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) ELISA kit for Human AOAH (Acyloxyacyl Hydrolase) |
|
ELK3978 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Acyloxyacyl Hydrolase (AOAH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Acylo
- Show more
|
|
Description: A sandwich ELISA kit for detection of Acyloxyacyl Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Epoxide hydrolase 2(EPHX2) ELISA kit |
|
CSB-EL007735HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Epoxide hydrolase 2 (EPHX2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Epoxide hydrolase 2(EPHX2) ELISA kit |
|
1-CSB-EL007735HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Epoxide hydrolase 2(EPHX2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 ELISA kit) Human Gamma-glutamyl hydrolase(GGH) ELISA kit |
|
CSB-EL009389HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Gamma-glutamyl hydrolase (GGH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Gamma-glutamyl hydrolase(GGH) ELISA kit |
|
1-CSB-EL009389HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Gamma-glutamyl hydrolase(GGH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 ELISA Kit) Human Hydroxyacylglutathione Hydrolase Like (HAGHL) ELISA Kit |
|
abx385019-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Human Lactase-phlorizin hydrolase (LCT) ELISA Kit |
|
abx385074-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Human Nudix Hydrolase 8 (NUDT8) ELISA Kit |
|
abx381920-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Human Probable hydrolase PNKD (PNKD) ELISA Kit |
|
abx382321-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Human S-formylglutathione hydrolase (ESD) ELISA Kit |
|
abx555912-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit |
|
abx572445-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 Human Ester hydrolase C11orf54, C11orf54 ELISA KIT |
|
ELI-33206h |
Lifescience Market |
96 Tests |
EUR 824 |
 Human Probable hydrolase PNKD, PNKD ELISA KIT |
|
ELI-36132h |
Lifescience Market |
96 Tests |
EUR 824 |
 Human Gamma- glutamyl hydrolase, GGH ELISA KIT |
|
ELI-47204h |
Lifescience Market |
96 Tests |
EUR 824 |
) Human Gamma-Glutamyl Hydrolase ELISA Kit (gGH) |
|
RK01457 |
Abclonal |
96 Tests |
EUR 521 |
) Human Leukotriene A4 Hydrolase ELISA Kit (LTA4H) |
|
RK01806 |
Abclonal |
96 Tests |
EUR 521 |
Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit |
|
SED236Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukotriene A4 Hydrolase (LTA4H) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukotriene A4 Hydrolase (LTA4H) in serum, plasma, tissue homogenates and other biological fluids. |
Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit |
|
SED236Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukotriene A4 Hydrolase (LTA4H) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukotriene A4 Hydrolase (LTA4H) in serum, plasma, tissue homogenates and other biological fluids. |
Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit |
|
SED236Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukotriene A4 Hydrolase (LTA4H) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukotriene A4 Hydrolase (LTA4H) in serum, plasma, tissue homogenates and other biological fluids. |
Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit
ELISA Kit)
ELISA Kit)