Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit

Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
4-SEJ123Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Fumarylacetoacetate Hydrolase elisa. Alternative names of the recognized antigen: FAA Fumarylacetoacetase Tyrosinemia 1 Beta-diketonase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fumarylacetoacetate Hydrolase (FAH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Fumarylacetoacetate Hydrolase (FAH) Antibody
abx026534-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Fumarylacetoacetate Hydrolase (FAH) Antibody
abx026534-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx005052	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Fumarylacetoacetate Hydrolase (FAH) Antibody
abx018095-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

Fumarylacetoacetate Hydrolase (FAH) Antibody
abx018096-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx102858	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx102859	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx112607	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Fumarylacetoacetate Hydrolase (FAH) Antibody
abx036126-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx317985	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fumarylacetoacetate Hydrolase (FAH) Antibody
abx232948-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Fumarylacetoacetate Hydrolase (FAH) Antibody
20-abx002320	Abbexa	EUR 495.00 EUR 356.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Fumarylacetoacetate Hydrolase (FAH)
4-RPJ123Hu01	Cloud-Clone	EUR 517.54 EUR 241.00 EUR 1665.76 EUR 621.92 EUR 1143.84 EUR 409.00 EUR 4014.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P16930 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.9kDa Isoelectric Point: Inquire
Description: Recombinant Human Fumarylacetoacetate Hydrolase expressed in: E.coli

Recombinant Fumarylacetoacetate Hydrolase (FAH)
4-RPJ123Hu02	Cloud-Clone	EUR 517.54 EUR 241.00 EUR 1665.76 EUR 621.92 EUR 1143.84 EUR 409.00 EUR 4014.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P16930 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Fumarylacetoacetate Hydrolase expressed in: E.coli

Mouse Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
20-abx389353	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Fumarylacetoacetate Hydrolase (FAH) Protein
20-abx066699	Abbexa	EUR 718.00 EUR 286.00 EUR 2249.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human Fumarylacetoacetate Hydrolase (FAH) Protein
20-abx066700	Abbexa	EUR 718.00 EUR 286.00 EUR 2249.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human Fumarylacetoacetate Hydrolase (FAH) CLIA Kit
20-abx495621	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human FAH (Fumarylacetoacetate Hydrolase)
ELK4894	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fumarylacetoacetate Hydrolase (FAH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t Show more
Description: A sandwich ELISA kit for detection of Fumarylacetoacetate Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Fumarylacetoacetate Hydrolase (FAH) Antibody (Biotin)
20-abx272420	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Fumarylacetoacetate Hydrolase (FAH) Antibody (HRP)
20-abx303802	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fumarylacetoacetate Hydrolase (FAH) Antibody (FITC)
20-abx303803	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fumarylacetoacetate Hydrolase (FAH) Antibody (Biotin)
20-abx303804	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human)
4-PAJ123Hu02	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Val189~Ser419) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH)

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), APC
4-PAJ123Hu02-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Val189~Ser419) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC.

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), Biotinylated
4-PAJ123Hu02-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Val189~Ser419) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Biotin.

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), Cy3
4-PAJ123Hu02-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Val189~Ser419) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Cy3.

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), FITC
4-PAJ123Hu02-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Val189~Ser419) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with FITC.

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), HRP
4-PAJ123Hu02-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Val189~Ser419) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with HRP.

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), PE
4-PAJ123Hu02-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Val189~Ser419) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with PE.

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat)
4-PAJ123Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Ile40~Leu195) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH)

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), APC-Cy7
4-PAJ123Hu02-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Val189~Ser419) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC-Cy7.

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), APC
4-PAJ123Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Ile40~Leu195) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC.

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated
4-PAJ123Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Ile40~Leu195) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Biotin.

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), Cy3
4-PAJ123Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Ile40~Leu195) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Cy3.

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), FITC
4-PAJ123Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Ile40~Leu195) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with FITC.

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), HRP
4-PAJ123Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Ile40~Leu195) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with HRP.

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), PE
4-PAJ123Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Ile40~Leu195) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with PE.

Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7
4-PAJ123Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FAH (Ile40~Leu195) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC-Cy7.

Anti-Fumarylacetoacetate hydrolase (3G2)
YF-MA12951	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Fumarylacetoacetate hydrolase

Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1
7-02743	CHI Scientific	5µg	Ask for price

Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1
7-02744	CHI Scientific	20µg	Ask for price

Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1
7-02745	CHI Scientific	1mg	Ask for price

Fumarylacetoacetate Hydrolase Domain Containing 1 (Recombinant)
20-abx073193	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Fah/ Rat Fah ELISA Kit
ELI-47608r	Lifescience Market	96 Tests	EUR 886

FAH ELISA KIT|Human
EF009501	Lifescience Market	96 Tests	EUR 689

FAHD1 Fumarylacetoacetate Hydrolase Domain Containing 1 Human Recombinant Protein
PROTQ6P587	BosterBio	Regular: 20ug	EUR 317
Description: FAHD1 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 244 amino acids (1-224 a.a.) and having a molecular mass of 27kDa. The FAHD1 is purified by proprietary chromatographic techniques.

Fumarylacetoacetate Hydrolase Domain-Containing Protein 2B (FAHD2B) Antibody
abx030304-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Fumarylacetoacetate Hydrolase Domain-Containing Protein 2B (FAHD2B) Antibody
abx030304-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Fumarylacetoacetate Hydrolase Domain-Containing Protein 2A (FAHD2A) Antibody
20-abx308897	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Fumarylacetoacetase, FAH ELISA KIT
ELI-09815h	Lifescience Market	96 Tests	EUR 824

FAH ELISA Kit (Human) (OKCD00555)
OKCD00555	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.058 ng/mL

Mouse Fah/ Fumarylacetoacetase ELISA Kit
E0499Mo	Sunlong	1 Kit	EUR 632

Mouse Fumarylacetoacetase, Fah ELISA KIT
ELI-32960m	Lifescience Market	96 Tests	EUR 865

Bovine Fumarylacetoacetase, FAH ELISA KIT
ELI-38504b	Lifescience Market	96 Tests	EUR 928

FAH ELISA Kit (Mouse) (OKEH08226)
OKEH08226	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.048ng/mL

Fah ELISA Kit| Mouse Fumarylacetoacetase ELISA Kit
EF014986	Lifescience Market	96 Tests	EUR 689

FAH ELISA Kit| Bovine Fumarylacetoacetase ELISA Kit
EF011403	Lifescience Market	96 Tests	EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

FAH antibody
70R-17200	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FAH antibody

FAH antibody
70R-1062	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal FAH antibody

FAH antibody
70R-2625	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FAH antibody

FAH antibody
39026-100ul	SAB	100ul	EUR 252

FAH Antibody
39846-100ul	SAB	100ul	EUR 390

FAH Antibody
1-CSB-PA007965GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FAH. Recognizes FAH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FAH Antibody
1-CSB-PA007965LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAH. Recognizes FAH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

FAH siRNA
20-abx901829	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FAH siRNA
20-abx915946	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FAH siRNA
20-abx915947	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human FAH shRNA Plasmid
20-abx951521	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FAH Recombinant Protein (Human)
RP011182	ABM	100 ug	Ask for price

FAH Rabbit pAb
A13492-100ul	Abclonal	100 ul	EUR 308

FAH Rabbit pAb
A13492-200ul	Abclonal	200 ul	EUR 459

FAH Rabbit pAb
A13492-20ul	Abclonal	20 ul	EUR 183

FAH Rabbit pAb
A13492-50ul	Abclonal	50 ul	EUR 223

FAH Blocking Peptide
33R-1054	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EPN1 antibody, catalog no. 70R-3618

FAH Blocking Peptide
33R-8429	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FAH antibody, catalog no. 70R-2625

FAH Conjugated Antibody
C39026	SAB	100ul	EUR 397

FAH cloning plasmid
CSB-CL007965HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1260 Sequence: atgtccttcatcccggtggccgaggattccgacttccccatccacaacctgccctacggcgtcttctcgaccagaggcgacccaagaccgaggataggtgtggccattggcgaccagatcctggacctcagcatcatcaagcacctctttactggtcctgtcctctccaaacacc Show more
Description: A cloning plasmid for the FAH gene.

FAH Rabbit pAb
A6586-100ul	Abclonal	100 ul	EUR 308

FAH Rabbit pAb
A6586-200ul	Abclonal	200 ul	EUR 459

FAH Rabbit pAb
A6586-20ul	Abclonal	20 ul	EUR 183

FAH Rabbit pAb
A6586-50ul	Abclonal	50 ul	EUR 223

FAH Polyclonal Antibody
A62538	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

FAH Rabbit pAb
A3238-100ul	Abclonal	100 ul	EUR 384

FAH Rabbit pAb
A3238-200ul	Abclonal	200 ul	Ask for price

FAH Rabbit pAb
A3238-20ul	Abclonal	20 ul	Ask for price

FAH Rabbit pAb
A3238-50ul	Abclonal	50 ul	EUR 265

anti- FAH antibody
FNab02948	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: fumarylacetoacetate hydrolase (fumarylacetoacetase) Uniprot ID: P16930 Gene ID: 2184 Research Area: Metabolism
Description: Antibody raised against FAH

Anti-FAH antibody
PAab02948	Lifescience Market	100 ug	EUR 355

Anti-FAH antibody
STJ28669	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT).

Anti-FAH antibody
STJ115453	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT).

Anti-FAH antibody
STJ23615	St John's Laboratory	100 µl	EUR 393
Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT).

FAH ORF Vector (Human) (pORF)
ORF003728	ABM	1.0 ug DNA	EUR 95

Human Acyloxyacyl Hydrolase (AOAH)ELISA Kit
201-12-2818	SunredBio	96 tests	EUR 440
This Acyloxyacyl Hydrolase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
DLR-AOAH-Hu-48T	DL Develop	48T	EUR 517
Should the Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
DLR-AOAH-Hu-96T	DL Develop	96T	EUR 673
Should the Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
DLR-BLMH-Hu-48T	DL Develop	48T	EUR 517
Should the Human Bleomycin Hydrolase (BLMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
DLR-BLMH-Hu-96T	DL Develop	96T	EUR 673
Should the Human Bleomycin Hydrolase (BLMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Bleomycin hydrolase(BLMH) ELISA kit
E01B0805-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bleomycin hydrolase(BLMH) ELISA kit
E01B0805-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bleomycin hydrolase(BLMH) ELISA kit
E01B0805-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
E01A1552-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
E01A1552-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
E01A1552-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human γ Glutamate Hydrolase ELISA kit
E01G0559-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human γ Glutamate Hydrolase ELISA kit
E01G0559-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human γ Glutamate Hydrolase ELISA kit
E01G0559-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit
E01H0015-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit
E01H0015-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit
E01H0015-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
20-abx150541	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
20-abx150813	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Hydroxyacylglutathione Hydrolase (HAGH) ELISA Kit
abx252611-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human HAGH(Hydroxyacylglutathione Hydrolase) ELISA Kit
EH3210	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q16775 Alias: HAGH/GLX2/HAGH/GLO2hydroxyacyl glutathione hydrolase/Glx II/GLXII/Glyoxalase II/HAGH1GLX2/hydroxyacylglutathione hydrolase/hydroxyacylglutathione hydrolase, mitochondrial/hydroxyacylglutathion Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Valacyclovir hydrolase, BPHL ELISA KIT
ELI-11153h	Lifescience Market	96 Tests	EUR 824

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
CSB-EL001853HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
1-CSB-EL001853HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase(AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Bleomycin hydrolase(BLMH) ELISA kit
CSB-EL002716HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase (BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Bleomycin hydrolase(BLMH) ELISA kit
1-CSB-EL002716HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase(BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Valacyclovir Hydrolase (BPHL) ELISA Kit
20-abx386067	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Acyloxyacyl hydrolase, AOAH ELISA KIT
ELI-34429h	Lifescience Market	96 Tests	EUR 824

Human Bleomycin hydrolase, BLMH ELISA KIT
ELI-50039h	Lifescience Market	96 Tests	EUR 824

Human Acyloxyacyl Hydrolase(AOAH)ELISA Kit
QY-E00892	Qayee Biotechnology	96T	EUR 361

Human Hydroxyacylglutathione Hydrolase(HAGH)ELISA Kit
QY-E01881	Qayee Biotechnology	96T	EUR 361

Human Bleomycin Hydrolase ELISA Kit (BLMH)
RK00979	Abclonal	96 Tests	EUR 521

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RDR-AOAH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RDR-AOAH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Bleomycin Hydrolase (BLMH) ELISA Kit
RDR-BLMH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Bleomycin Hydrolase (BLMH) ELISA Kit
RDR-BLMH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
4-SEC220Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Bleomycin Hydrolase elisa. Alternative names of the recognized antigen: BH BMH
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RD-AOAH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RD-AOAH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Bleomycin Hydrolase (BLMH) ELISA Kit
RD-BLMH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Bleomycin Hydrolase (BLMH) ELISA Kit
RD-BLMH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
4-SEJ634Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Acyloxyacyl Hydrolase elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Rat FAH shRNA Plasmid
20-abx985461	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FAH Antibody, HRP conjugated
1-CSB-PA007965LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAH. Recognizes FAH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FAH Antibody, FITC conjugated
1-CSB-PA007965LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAH. Recognizes FAH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FAH Antibody, Biotin conjugated
1-CSB-PA007965LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAH. Recognizes FAH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse FAH shRNA Plasmid
20-abx970277	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FAH Recombinant Protein (Rat)
RP200270	ABM	100 ug	Ask for price

FAH Recombinant Protein (Mouse)
RP132728	ABM	100 ug	Ask for price

Recombinant Human Fumarylacetoacetase/FAH (C-6His)
C874-10ug	Novoprotein	10ug	EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fumarylacetoacetase/FAH (C-6His)
C874-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fumarylacetoacetase/FAH (C-6His)
C874-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fumarylacetoacetase/FAH (C-6His)
C874-50ug	Novoprotein	50ug	EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

FAH sgRNA CRISPR Lentivector set (Human)
K0711501	ABM	3 x 1.0 ug	EUR 339

Human peptidyl-tRNA hydrolase,PTRH ELISA Kit
201-12-2032	SunredBio	96 tests	EUR 440
This peptidyl-tRNA hydrolase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ELISA kit for Human HAGH (Hydroxyacylglutathione Hydrolase)
E-EL-H1078	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's HAGH ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human HAGH. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human HAGH (Hydroxyacylglutathione Hydrolase) in samples from Serum, Plasma, Cell supernatant

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit
DLR-LTA4H-Hu-48T	DL Develop	48T	EUR 517
Should the Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukotriene A4 Hydrolase (LTA4H) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit
DLR-LTA4H-Hu-96T	DL Develop	96T	EUR 673
Should the Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukotriene A4 Hydrolase (LTA4H) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit
DLR-gGH-Hu-48T	DL Develop	48T	EUR 517
Should the Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Gamma-Glutamyl Hydrolase (gGH) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit
DLR-gGH-Hu-96T	DL Develop	96T	EUR 673
Should the Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Gamma-Glutamyl Hydrolase (gGH) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Lactase-phlorizin hydrolase(LCT) ELISA kit
CSB-EL012827HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lactase-phlorizin hydrolase (LCT) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Lactase-phlorizin hydrolase(LCT) ELISA kit
1-CSB-EL012827HU	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lactase-phlorizin hydrolase(LCT) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Epoxide hydrolase 1(EPHX1) ELISA kit
E01E0380-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 1(EPHX1) ELISA kit
E01E0380-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 1(EPHX1) ELISA kit
E01E0380-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 2(EPHX2) ELISA kit
E01E0381-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 2(EPHX2) ELISA kit
E01E0381-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 2(EPHX2) ELISA kit
E01E0381-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA kit
E01L0040-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 Hydrolase (LTA4H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA kit
E01L0040-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 Hydrolase (LTA4H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA kit
E01L0040-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 Hydrolase (LTA4H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human gamma Glutamyl Hydrolase (gGH) ELISA Kit
20-abx151653	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit
20-abx152241	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Gamma-Glutamyl Hydrolase (GGH) ELISA Kit
abx257522-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human ADP Ribosylarginine Hydrolase (ADPRH) ELISA Kit
20-abx258631	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Epoxide Hydrolase 4 (EPHX4) ELISA Kit
abx251403-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit
abx252710-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human LTA4H(Leukotriene A4 Hydrolase) ELISA Kit
EH3307	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: P09960 Alias: LTA4H/EC 3.3.2.6/Leukotriene A(4) hydrolase/leukotriene A4 hydrolase/leukotriene A-4 hydrolase/LTA4/LTA-4 hydrolase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human GGH(Gamma-glutamyl hydrolase) ELISA Kit
EH4206	FN Test	96T	EUR 524.1
Detection range: 0.469-30 ng/ml Uniprot ID: Q92820
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.281 ng/ml

Human EPHX4/ Epoxide hydrolase 4 ELISA Kit
E0804Hu	Sunlong	1 Kit	EUR 571

Human ESD/ S-formylglutathione hydrolase ELISA Kit
E0819Hu	Sunlong	1 Kit	EUR 605

Human EPHX4(Epoxide hydrolase 4) ELISA Kit
EH2072	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q8IUS5 Alias: EPHX4(Epoxide hydrolase 4)/ABHD7/EPHXRP/Abhydrolase domain-containing protein 7/Epoxide hydrolase-related protein
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Putative hydrolase RBBP9, RBBP9 ELISA KIT
ELI-14004h	Lifescience Market	96 Tests	EUR 824

Human Mitochondrial cardiolipin hydrolase, PLD6 ELISA KIT
ELI-15234h	Lifescience Market	96 Tests	EUR 824

Human Epoxide hydrolase 3, EPHX3 ELISA KIT
ELI-09713h	Lifescience Market	96 Tests	EUR 824

Human Lactase- phlorizin hydrolase, LCT ELISA KIT
ELI-23573h	Lifescience Market	96 Tests	EUR 824

Human Epoxide hydrolase 4, EPHX4 ELISA KIT
ELI-06582h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human BLMH (Bleomycin Hydrolase)
ELK3153	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Bleomycin Hydrolase (BLMH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Bleomyc Show more
Description: A sandwich ELISA kit for detection of Bleomycin Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human AOAH (Acyloxyacyl Hydrolase)
ELK3978	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Acyloxyacyl Hydrolase (AOAH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Acylo Show more
Description: A sandwich ELISA kit for detection of Acyloxyacyl Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Epoxide hydrolase 2, EPHX2 ELISA KIT
ELI-42180h	Lifescience Market	96 Tests	EUR 824

Human Epoxide hydrolase 1, EPHX1 ELISA KIT
ELI-43306h	Lifescience Market	96 Tests	EUR 824

Human Epoxide hydrolase 2(EPHX2) ELISA kit
CSB-EL007735HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Epoxide hydrolase 2 (EPHX2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Epoxide hydrolase 2(EPHX2) ELISA kit
1-CSB-EL007735HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Epoxide hydrolase 2(EPHX2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Gamma-glutamyl hydrolase(GGH) ELISA kit
CSB-EL009389HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Gamma-glutamyl hydrolase (GGH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Gamma-glutamyl hydrolase(GGH) ELISA kit
1-CSB-EL009389HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Gamma-glutamyl hydrolase(GGH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Hydroxyacylglutathione Hydrolase Like (HAGHL) ELISA Kit
abx385019-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Lactase-phlorizin hydrolase (LCT) ELISA Kit
abx385074-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Nudix Hydrolase 8 (NUDT8) ELISA Kit
abx381920-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Probable hydrolase PNKD (PNKD) ELISA Kit
abx382321-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human S-formylglutathione hydrolase (ESD) ELISA Kit
abx555912-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit
abx572445-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Ester hydrolase C11orf54, C11orf54 ELISA KIT
ELI-33206h	Lifescience Market	96 Tests	EUR 824

Human Probable hydrolase PNKD, PNKD ELISA KIT
ELI-36132h	Lifescience Market	96 Tests	EUR 824

Human Gamma- glutamyl hydrolase, GGH ELISA KIT
ELI-47204h	Lifescience Market	96 Tests	EUR 824

Human peptidyl-tRNA hydrolase(PTRH)ELISA Kit
QY-E01313	Qayee Biotechnology	96T	EUR 361

Human Gamma-Glutamyl Hydrolase ELISA Kit (gGH)
RK01457	Abclonal	96 Tests	EUR 521

Human Leukotriene A4 Hydrolase ELISA Kit (LTA4H)
RK01806	Abclonal	96 Tests	EUR 521

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit
SED236Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukotriene A4 Hydrolase (LTA4H) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukotriene A4 Hydrolase (LTA4H) in serum, plasma, tissue homogenates and other biological fluids.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit
SED236Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukotriene A4 Hydrolase (LTA4H) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukotriene A4 Hydrolase (LTA4H) in serum, plasma, tissue homogenates and other biological fluids.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit
SED236Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukotriene A4 Hydrolase (LTA4H) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukotriene A4 Hydrolase (LTA4H) in serum, plasma, tissue homogenates and other biological fluids.

Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit