Human CPN2(Carboxypeptidase N2) ELISA Kit
 ELISA Kit) Human CPN2(Carboxypeptidase N2) ELISA Kit |
|
EH4305 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78.125-5000 pg/ml
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml |
 ELISA Kit) Human Carboxypeptidase N2 (CPN2) ELISA Kit |
|
SEF324Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Carboxypeptidase N2 (CPN2) ELISA Kit |
|
SEF324Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Carboxypeptidase N2 (CPN2) ELISA Kit |
|
SEF324Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Carboxypeptidase N2 (CPN2) ELISA Kit |
|
SEF324Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Carboxypeptidase N2 (CPN2) ELISA Kit |
|
4-SEF324Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Carboxypeptidase N2 elisa. Alternative names of the recognized antigen: ACBP
- Carboxypeptidase N 83 kDa chain
- Carboxypeptidase N large subunit
- Carboxypeptidase N regulatory subunit
- Carboxypeptidase N polypeptide 2
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxypeptidase N2 (CPN2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
 Antibody) Carboxypeptidase N2 (CPN2) Antibody |
|
abx027272-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Carboxypeptidase N2 (CPN2) Antibody |
|
abx027272-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Carboxypeptidase N2 (CPN2) Antibody |
|
20-abx175702 |
Abbexa |
|
|
|
|
Carboxypeptidase N2 (CPN2) Antibody |
|
20-abx129010 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Carboxypeptidase N2 (CPN2) Antibody |
|
20-abx171569 |
Abbexa |
|
|
|
|
Carboxypeptidase N2 (CPN2) Antibody |
|
20-abx014322 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Carboxypeptidase N2 (CPN2) Antibody |
|
abx330718-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Carboxypeptidase N2 (CPN2) Antibody |
|
20-abx323544 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) Recombinant Carboxypeptidase N2 (CPN2) |
|
4-RPF324Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P22792
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 36.3kDa
- Isoelectric Point: 6.6
|
|
Description: Recombinant Human Carboxypeptidase N2 expressed in: E.coli |
 ELISA Kit) Rat Carboxypeptidase N2 (CPN2) ELISA Kit |
|
20-abx155298 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
ELISA Kit) Rat Carboxypeptidase N2(CPN2)ELISA Kit |
|
GA-E0867RT-48T |
GenAsia Biotech |
48T |
EUR 317 |
Rat Carboxypeptidase N2(CPN2)ELISA Kit |
|
GA-E0867RT-96T |
GenAsia Biotech |
96T |
EUR 496 |
Rat Carboxypeptidase N2 (CPN2) ELISA Kit |
|
SEF324Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Carboxypeptidase N2 (CPN2) ELISA Kit |
|
SEF324Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Carboxypeptidase N2 (CPN2) ELISA Kit |
|
SEF324Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Carboxypeptidase N2 (CPN2) ELISA Kit |
|
SEF324Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Carboxypeptidase N2 (CPN2) ELISA Kit |
|
4-SEF324Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Carboxypeptidase N2 elisa. Alternative names of the recognized antigen: ACBP
- Carboxypeptidase N 83 kDa chain
- Carboxypeptidase N large subunit
- Carboxypeptidase N regulatory subunit
- Carboxypeptidase N polypeptide 2
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Carboxypeptidase N2 (CPN2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
 Protein) Human Carboxypeptidase N2 (CPN2) Protein |
|
20-abx168138 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 CLIA Kit) Human Carboxypeptidase N2 (CPN2) CLIA Kit |
|
20-abx494865 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
) ELISA kit for Human CPN2 (Carboxypeptidase N2) |
|
ELK5042 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxypeptidase N2 (CPN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxy
- Show more
|
|
Description: A sandwich ELISA kit for detection of Carboxypeptidase N2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 Protein) Rat Carboxypeptidase N2 (CPN2) Protein |
|
20-abx652777 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 CLIA Kit) Rat Carboxypeptidase N2 (CPN2) CLIA Kit |
|
20-abx494866 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
) ELISA kit for Rat CPN2 (Carboxypeptidase N2) |
|
ELK6729 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxypeptidase N2 (CPN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxy
- Show more
|
|
Description: A sandwich ELISA kit for detection of Carboxypeptidase N2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 Polyclonal Antibody (Human)) Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human) |
|
4-PAF324Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPN2 (Gln249~Ala540)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2) |
 Polyclonal Antibody (Human), APC) Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), APC |
|
4-PAF324Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPN2 (Gln249~Ala540)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), Biotinylated |
|
4-PAF324Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPN2 (Gln249~Ala540)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), Cy3 |
|
4-PAF324Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPN2 (Gln249~Ala540)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), FITC |
|
4-PAF324Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPN2 (Gln249~Ala540)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), HRP |
|
4-PAF324Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPN2 (Gln249~Ala540)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), PE |
|
4-PAF324Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPN2 (Gln249~Ala540)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with PE. |
 Polyclonal Antibody (Human), APC-Cy7) Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAF324Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPN2 (Gln249~Ala540)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with APC-Cy7. |
 Carboxypeptidase N2 antibody |
|
70R-49584 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal Carboxypeptidase N2 antibody |
Carboxypeptidase N2 antibody |
|
70R-3276 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal Carboxypeptidase N2 antibody raised against the N terminal of CPN2 |
 Carboxypeptidase N2 Blocking Peptide |
|
33R-3103 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CPN2 antibody, catalog no. 70R-3276 |
 Human CPN2/ Carboxypeptidase N subunit 2 ELISA Kit |
|
E0548Hu |
Sunlong |
1 Kit |
EUR 571 |
 ELISA kit) Human Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E01C2009-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E01C2009-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E01C2009-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
CSB-EL005899HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase N subunit 2 (CPN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
1-CSB-EL005899HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase N subunit 2(CPN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 ELISA Kit) Human Carboxypeptidase N Subunit 2 (CPN2) ELISA Kit |
|
abx512707-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 Antibody) Carboxypeptidase N 2 (CPN2) Antibody |
|
20-abx009403 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
 ELISA kit) Rat Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E02C2009-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E02C2009-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E02C2009-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Mouse Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E03C2009-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E03C2009-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E03C2009-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Goat Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E06C2009-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E06C2009-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E06C2009-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Rabbit Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E04C2009-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E04C2009-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E04C2009-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Monkey Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E09C2009-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E09C2009-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E09C2009-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Dog Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E08C2009-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E08C2009-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E08C2009-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Pig Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E07C2009-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E07C2009-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E07C2009-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA Kit) Mouse Carboxypeptidase N Subunit 2 (CPN2) ELISA Kit |
|
abx512708-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA kit) Guinea pig Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E05C2009-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E05C2009-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Carboxypeptidase N subunit 2(CPN2) ELISA kit |
|
E05C2009-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 (OKCD00699)) CPN2 ELISA Kit (Human) (OKCD00699) |
|
OKCD00699 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
|
Description: Description of target: The 83 kDa subunit binds and stabilizes the catalytic subunit at 37 degrees Celsius and keeps it in circulation. Under some circumstances it may be an allosteric modifier of the catalytic subunit. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL |
 (OKEH06913)) CPN2 ELISA Kit (Human) (OKEH06913) |
|
OKEH06913 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: The 83 kDa subunit binds and stabilizes the catalytic subunit at 37 degrees Celsius and keeps it in circulation. Under some circumstances it may be an allosteric modifier of the catalytic subunit. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78U/L |
 (OKCD08772)) CPN2 ELISA Kit (Rat) (OKCD08772) |
|
OKCD08772 |
Aviva Systems Biology |
96 Wells |
EUR 1053 |
|
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL |
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 CPN2 Antibody |
|
34551-100ul |
SAB |
100ul |
EUR 252 |
CPN2 Antibody |
|
34551-50ul |
SAB |
50ul |
EUR 187 |
CPN2 Antibody |
|
DF3901 |
Affbiotech |
200ul |
EUR 304 |
|
Description: CPN2 Antibody detects endogenous levels of total CPN2. |
CPN2 Antibody |
|
CSB-PA276934- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
|
Description: A polyclonal antibody against CPN2. Recognizes CPN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
CPN2 Antibody |
|
CSB-PA276934-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
|
Description: A polyclonal antibody against CPN2. Recognizes CPN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
 CPN2 antibody |
|
70R-37038 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit Polyclonal CPN2 antibody |
CPN2 Antibody |
|
1-CSB-PA007245 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against CPN2. Recognizes CPN2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
 CPN2 siRNA |
|
20-abx912672 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CPN2 siRNA |
|
20-abx912673 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Bacopaside N2 |
|
TBW00873 |
ChemNorm |
5mg |
Ask for price |
 Human Carboxypeptidase B1 ELISA kit |
|
E01C0730-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase B1 ELISA kit |
|
E01C0730-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase B1 ELISA kit |
|
E01C0730-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human CPN2 shRNA Plasmid |
|
20-abx950959 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) CPN2 Recombinant Protein (Human) |
|
RP038263 |
ABM |
100 ug |
Ask for price |
 Human Forkhead box protein N2, FOXN2 ELISA KIT |
|
ELI-27523h |
Lifescience Market |
96 Tests |
EUR 824 |
 Anti-CPN2 Antibody |
|
A05815 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal CPN2 Antibody. Validated in WB and tested in Human. |
 CPN2 Blocking Peptide |
|
DF3901-BP |
Affbiotech |
1mg |
EUR 195 |
 CPN2 Conjugated Antibody |
|
C34551 |
SAB |
100ul |
EUR 397 |
 CPN2 cloning plasmid |
|
CSB-CL005899HU-10ug |
Cusabio |
10ug |
EUR 569 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1638
- Sequence: ATGCTCCCTGGAGCCTGGCTGCTCTGGACCTCCCTCCTGCTCCTGGCCAGGCCTGCCCAGCCCTGTCCCATGGGTTGTGACTGCTTCGTCCAGGAGGTGTTCTGCTCAGATGAGGAGCTTGCCACCGTCCCGCTGGACATCCCGCCATATACGAAAAACATCATCTTTGTGGAGA
- Show more
|
|
Description: A cloning plasmid for the CPN2 gene. |
ELISA Kit) Human Carboxypeptidase N1 (CPN1)ELISA Kit |
|
201-12-2436 |
SunredBio |
96 tests |
EUR 440 |
- This Carboxypeptidase N1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 ELISA Kit) Human Carboxypeptidase A4 (CPA4) ELISA Kit |
|
DLR-CPA4-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Carboxypeptidase A4 (CPA4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase A4 (CPA4) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Carboxypeptidase A4 (CPA4) ELISA Kit |
|
DLR-CPA4-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Carboxypeptidase A4 (CPA4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase A4 (CPA4) in samples from serum, plasma, tissue homogenates or other biological fluids. |
 ELISA Kit) Human Carboxypeptidase E (CPE) ELISA Kit |
|
DLR-CPE-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Carboxypeptidase E (CPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase E (CPE) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Carboxypeptidase E (CPE) ELISA Kit |
|
DLR-CPE-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Carboxypeptidase E (CPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase E (CPE) in samples from tissue homogenates, cell lysates or other biological fluids. |
 ELISA Kit) Human Carboxypeptidase M (CPM) ELISA Kit |
|
DLR-CPM-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Carboxypeptidase M (CPM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase M (CPM) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Carboxypeptidase M (CPM) ELISA Kit |
|
DLR-CPM-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Carboxypeptidase M (CPM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase M (CPM) in samples from serum, plasma, tissue homogenates or other biological fluids. |
 ELISA Kit) Human Carboxypeptidase N1 (CPN1) ELISA Kit |
|
DLR-CPN1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Carboxypeptidase N1 (CPN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase N1 (CPN1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Carboxypeptidase N1 (CPN1) ELISA Kit |
|
DLR-CPN1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Carboxypeptidase N1 (CPN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase N1 (CPN1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
 ELISA Kit) Human Carboxypeptidase Z (CPZ) ELISA Kit |
|
DLR-CPZ-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Carboxypeptidase Z (CPZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase Z (CPZ) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Carboxypeptidase Z (CPZ) ELISA Kit |
|
DLR-CPZ-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Carboxypeptidase Z (CPZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase Z (CPZ) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
 Human CPA2/ Carboxypeptidase A2 ELISA Kit |
|
E0543Hu |
Sunlong |
1 Kit |
EUR 571 |
 Human CPB2/ Carboxypeptidase B2 ELISA Kit |
|
E0545Hu |
Sunlong |
1 Kit |
EUR 571 |
 Human CPM/ Carboxypeptidase M ELISA Kit |
|
E0547Hu |
Sunlong |
1 Kit |
EUR 571 |
 ELISA kit) Human Carboxypeptidase A1(CPA1) ELISA kit |
|
E01C1990-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase A1(CPA1) ELISA kit |
|
E01C1990-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase A1(CPA1) ELISA kit |
|
E01C1990-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Human Carboxypeptidase A2(CPA2) ELISA kit |
|
E01C1991-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A2(CPA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase A2(CPA2) ELISA kit |
|
E01C1991-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A2(CPA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase A2(CPA2) ELISA kit |
|
E01C1991-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A2(CPA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Human Carboxypeptidase A4(CPA4) ELISA kit |
|
E01C1992-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase A4(CPA4) ELISA kit |
|
E01C1992-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase A4(CPA4) ELISA kit |
|
E01C1992-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Human Carboxypeptidase A5(CPA5) ELISA kit |
|
E01C1993-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A5(CPA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase A5(CPA5) ELISA kit |
|
E01C1993-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A5(CPA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human CPN2(Carboxypeptidase N2) ELISA Kit
ELISA Kit)
ELISA Kit)
ELISA Kit)
ELISA Kit)
ELISA Kit)