Human CDSN(Corneodesmosin) ELISA Kit

Human CDSN(Corneodesmosin) ELISA Kit

Human Corneodesmosin (CDSN) ELISA Kit
RD-CDSN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Corneodesmosin (CDSN) ELISA Kit
RD-CDSN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Corneodesmosin (CDSN) ELISA Kit
RDR-CDSN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Corneodesmosin (CDSN) ELISA Kit
RDR-CDSN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Corneodesmosin, CDSN ELISA KIT
ELI-33835h	Lifescience Market	96 Tests	EUR 824

Human Corneodesmosin (CDSN) ELISA Kit
20-abx156900	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Corneodesmosin (CDSN) ELISA Kit
abx252173-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Corneodesmosin (CDSN) ELISA Kit
SEC369Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Corneodesmosin (CDSN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Corneodesmosin (CDSN) in tissue homogenates, cell lysates and other biological fluids.

Human Corneodesmosin (CDSN) ELISA Kit
SEC369Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Corneodesmosin (CDSN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Corneodesmosin (CDSN) in tissue homogenates, cell lysates and other biological fluids.

Human Corneodesmosin (CDSN) ELISA Kit
SEC369Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Corneodesmosin (CDSN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Corneodesmosin (CDSN) in tissue homogenates, cell lysates and other biological fluids.

Human Corneodesmosin (CDSN) ELISA Kit
SEC369Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Corneodesmosin (CDSN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Corneodesmosin (CDSN) in tissue homogenates, cell lysates and other biological fluids.

Human Corneodesmosin (CDSN) ELISA Kit
4-SEC369Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Corneodesmosin elisa. Alternative names of the recognized antigen: HTSS S protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Corneodesmosin (CDSN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Corneodesmosin ELISA Kit (CDSN)
RK01084	Abclonal	96 Tests	EUR 521

Pig Corneodesmosin (CDSN) ELISA Kit
abx360692-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Corneodesmosin (CDSN) ELISA Kit
abx363465-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Porcine Corneodesmosin, CDSN ELISA KIT
ELI-33142p	Lifescience Market	96 Tests	EUR 928

Mouse Corneodesmosin, Cdsn ELISA KIT
ELI-49923m	Lifescience Market	96 Tests	EUR 865

Monkey Corneodesmosin (CDSN) ELISA Kit
abx358695-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Corneodesmosin (CDSN) ELISA Kit
abx355647-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Corneodesmosin (CDSN) Antibody
20-abx111802	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Corneodesmosin (CDSN) Antibody
20-abx317862	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Corneodesmosin (CDSN) Antibody
abx432488-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Corneodesmosin (CDSN) Antibody
20-abx171924	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Corneodesmosin (CDSN)
4-RPC369Hu01	Cloud-Clone	EUR 341.92 EUR 194.00 EUR 1007.20 EUR 402.40 EUR 704.80 EUR 292.00 EUR 2368.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q15517 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 59.5kDa Isoelectric Point: 7.8
Description: Recombinant Human Corneodesmosin expressed in: E.coli

ELISA kit for Human CDSN (Corneodesmosin)
ELK5202	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Corneodesmosin (CDSN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Corneodesmos Show more
Description: A sandwich ELISA kit for detection of Corneodesmosin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human CDSN (Corneodesmosin)
E-EL-H1497	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CDSN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CDSN. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CDSN (Corneodesmosin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Corneodesmosin (CDSN)
KTE62425-48T	Abbkine	48T	EUR 332
Corneodesmosin is a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. During maturation of the cornified layers, the protein undergoes a series of cleavages, which are thought to be required Show more
Description: Quantitative sandwich ELISA for measuring Human Corneodesmosin (CDSN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Corneodesmosin (CDSN)
KTE62425-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Corneodesmosin is a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. During maturation of the cornified layers, the protein undergoes a series of cleavages, which are thought to be required Show more
Description: Quantitative sandwich ELISA for measuring Human Corneodesmosin (CDSN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Corneodesmosin (CDSN)
KTE62425-96T	Abbkine	96T	EUR 539
Corneodesmosin is a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. During maturation of the cornified layers, the protein undergoes a series of cleavages, which are thought to be required Show more
Description: Quantitative sandwich ELISA for measuring Human Corneodesmosin (CDSN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Corneodesmosin (CDSN) CLIA Kit
abx196565-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Corneodesmosin (CDSN) CLIA Kit
20-abx493645	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Corneodesmosin (CDSN) Protein
20-abx650839	Abbexa	EUR 495.00 EUR 244.00 EUR 1372.00 EUR 565.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Guinea pig Corneodesmosin (CDSN) ELISA Kit
abx357640-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Cdsn ELISA Kit| Mouse Corneodesmosin ELISA Kit
EF014547	Lifescience Market	96 Tests	EUR 689

Corneodesmosin (CDSN) Antibody (HRP)
20-abx312640	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Corneodesmosin (CDSN) Antibody (FITC)
20-abx312641	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Corneodesmosin (CDSN) Antibody (Biotin)
20-abx312642	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

CLIA kit for Human CDSN (Corneodesmosin)
E-CL-H0965	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's CDSN CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human CDSN . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human CDSN (Corneodesmosin) in samples from Serum, Plasma, Cell supernatant

Corneodesmosin (CDSN) Polyclonal Antibody (Human)
4-PAC369Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys33~Gly300 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN)

Recombinant Human Corneodesmosin/CDSN (C-6His)
C590-10ug	Novoprotein	10ug	EUR 121
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Corneodesmosin/CDSN (C-6His)
C590-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Corneodesmosin/CDSN (C-6His)
C590-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Corneodesmosin/CDSN (C-6His)
C590-50ug	Novoprotein	50ug	EUR 263
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Corneodesmosin (CDSN) Polyclonal Antibody (Human), APC
4-PAC369Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys33~Gly300 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN). This antibody is labeled with APC.

Corneodesmosin (CDSN) Polyclonal Antibody (Human), Biotinylated
4-PAC369Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys33~Gly300 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN). This antibody is labeled with Biotin.

Corneodesmosin (CDSN) Polyclonal Antibody (Human), Cy3
4-PAC369Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys33~Gly300 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN). This antibody is labeled with Cy3.

Corneodesmosin (CDSN) Polyclonal Antibody (Human), FITC
4-PAC369Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys33~Gly300 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN). This antibody is labeled with FITC.

Corneodesmosin (CDSN) Polyclonal Antibody (Human), HRP
4-PAC369Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys33~Gly300 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN). This antibody is labeled with HRP.

Corneodesmosin (CDSN) Polyclonal Antibody (Human), PE
4-PAC369Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys33~Gly300 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN). This antibody is labeled with PE.

Corneodesmosin (CDSN) Polyclonal Antibody (Human), APC-Cy7
4-PAC369Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys33~Gly300 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN). This antibody is labeled with APC-Cy7.

Human Corneodesmosin ELISA kit
E01C0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Corneodesmosin ELISA kit
E01C0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Corneodesmosin ELISA kit
E01C0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CDSN ELISA Kit
EHC0413	Abclonal	96Tests	EUR 521

CDSN ELISA KIT|Human
EF006683	Lifescience Market	96 Tests	EUR 689

Goat Corneodesmosin ELISA kit
E06C0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Corneodesmosin ELISA kit
E06C0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Corneodesmosin ELISA kit
E06C0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Corneodesmosin ELISA kit
E02C0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Corneodesmosin ELISA kit
E02C0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Corneodesmosin ELISA kit
E02C0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Corneodesmosin ELISA kit
E03C0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Corneodesmosin ELISA kit
E03C0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Corneodesmosin ELISA kit
E03C0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Corneodesmosin ELISA kit
E04C0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Corneodesmosin ELISA kit
E04C0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Corneodesmosin ELISA kit
E04C0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Corneodesmosin ELISA kit
E07C0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Corneodesmosin ELISA kit
E07C0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Corneodesmosin ELISA kit
E07C0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Corneodesmosin ELISA kit
E08C0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Corneodesmosin ELISA kit
E08C0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Corneodesmosin ELISA kit
E08C0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Corneodesmosin ELISA kit
E09C0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Corneodesmosin ELISA kit
E09C0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Corneodesmosin ELISA kit
E09C0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CDSN ELISA Kit (Human) (OKAN06160)
OKAN06160	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. The encoded protein undergoes a series of cleavages during corneocyte maturation. This gene is highly polymorphic in human populations, and variation has been associated with skin diseases such as psoriasis, hypotrichosis and peeling skin syndrome. The gene is located in the major histocompatibility complex (MHC) class I region on chromosome 6.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

CDSN ELISA Kit (Human) (OKCD08104)
OKCD08104	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. The encoded protein undergoes a series of cleavages during corneocyte maturation. This gene is highly polymorphic in human populations, and variation has been associated with skin diseases such as psoriasis, hypotrichosis and peeling skin syndrome. The gene is located in the major histocompatibility complex (MHC) class I region on chromosome 6.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

CDSN ELISA Kit (Human) (OKDD00180)
OKDD00180	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. The encoded protein undergoes a series of cleavages during corneocyte maturation. This gene is highly polymorphic in human populations, and variation has been associated with skin diseases such as psoriasis, hypotrichosis and peeling skin syndrome. The gene is located in the major histocompatibility complex (MHC) class I region on chromosome 6.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.038 ng/mL

Goat CDSN ELISA Kit
EGTC0413	Abclonal	96Tests	EUR 521

Canine CDSN ELISA Kit
ECC0413	Abclonal	96Tests	EUR 521

Chicken CDSN ELISA Kit
ECKC0413	Abclonal	96Tests	EUR 521

Bovine CDSN ELISA Kit
EBC0413	Abclonal	96Tests	EUR 521

Anserini CDSN ELISA Kit
EAC0413	Abclonal	96Tests	EUR 521

Porcine CDSN ELISA Kit
EPC0413	Abclonal	96Tests	EUR 521

Rat CDSN ELISA Kit
ERC0413	Abclonal	96Tests	EUR 521

Rabbit CDSN ELISA Kit
ERTC0413	Abclonal	96Tests	EUR 521

Sheep CDSN ELISA Kit
ESC0413	Abclonal	96Tests	EUR 521

Mouse CDSN ELISA Kit
EMC0413	Abclonal	96Tests	EUR 521

Monkey CDSN ELISA Kit
EMKC0413	Abclonal	96Tests	EUR 521

Guinea pig Corneodesmosin ELISA kit
E05C0406-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Corneodesmosin ELISA kit
E05C0406-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Corneodesmosin ELISA kit
E05C0406-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea Pig CDSN ELISA Kit
EGC0413	Abclonal	96Tests	EUR 521

anti-Corneodesmosin
YF-PA23430	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Corneodesmosin

CDSN siRNA
20-abx911356	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CDSN siRNA
20-abx911357	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CDSN antibody
70R-16342	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CDSN antibody

CDSN Antibody
1-CSB-PA005124GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDSN. Recognizes CDSN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

CDSN Antibody
1-CSB-PA005124LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDSN. Recognizes CDSN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human CDSN shRNA Plasmid
20-abx950751	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CDSN Recombinant Protein (Human)
RP006709	ABM	100 ug	Ask for price

Corneodesmosin (CDS2) Antibody
20-abx131172	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Corneodesmosin (CDS2) Antibody
abx231570-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Anti-Corneodesmosin (5B4)
YF-MA12395	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Corneodesmosin

Anti-Corneodesmosin (6F11)
YF-MA10154	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Corneodesmosin

CDSN cloning plasmid
CSB-CL005124HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1587 Sequence: atgggctcgtctcgggcaccctggatggggcgtgtgggtgggcacgggatgttggcactgctgctggctggtctcctcctgccagggaccttggctaagagcattggcaccttctcagacccctgtaaggaccccacgcgtatcacctcccctaacgacccctgcctcactggga Show more
Description: A cloning plasmid for the CDSN gene.

CDSN Rabbit pAb
A14568-100ul	Abclonal	100 ul	EUR 308

CDSN Rabbit pAb
A14568-200ul	Abclonal	200 ul	EUR 459

CDSN Rabbit pAb
A14568-20ul	Abclonal	20 ul	EUR 183

CDSN Rabbit pAb
A14568-50ul	Abclonal	50 ul	EUR 223

CDSN Rabbit pAb
A14602-100ul	Abclonal	100 ul	EUR 308

CDSN Rabbit pAb
A14602-200ul	Abclonal	200 ul	EUR 459

CDSN Rabbit pAb
A14602-20ul	Abclonal	20 ul	EUR 183

CDSN Rabbit pAb
A14602-50ul	Abclonal	50 ul	EUR 223

CDSN Polyclonal Antibody
28623-100ul	SAB	100ul	EUR 252

CDSN Polyclonal Antibody
28623-50ul	SAB	50ul	EUR 187

CDSN Polyclonal Antibody
28643-100ul	SAB	100ul	EUR 252

CDSN Polyclonal Antibody
28643-50ul	SAB	50ul	EUR 187

Anti-CDSN antibody
STJ72420	St John's Laboratory	100 µg	EUR 359

Anti-CDSN antibody
STJ116779	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. The encoded protein undergoes a series of cleavages during corneocyte maturation. This gene is highly polymorphic in human populations, and variation has been associated with skin diseases such as psoriasis, hypotrichosis and peeling skin syndrome. The gene is located in the major histocompatibility complex (MHC) class I region on chromosome 6.

Anti-CDSN antibody
STJ116812	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. The encoded protein undergoes a series of cleavages during corneocyte maturation. This gene is highly polymorphic in human populations, and variation has been associated with skin diseases such as psoriasis, hypotrichosis and peeling skin syndrome. The gene is located in the major histocompatibility complex (MHC) class I region on chromosome 6.

CDSN ORF Vector (Human) (pORF)
ORF002237	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

CDSN Polyclonal Conjugated Antibody
C28623	SAB	100ul	EUR 397

CDSN Polyclonal Conjugated Antibody
C28643	SAB	100ul	EUR 397

Mouse CDSN shRNA Plasmid
20-abx983930	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CDSN Antibody, HRP conjugated
1-CSB-PA005124LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDSN. Recognizes CDSN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CDSN Antibody, FITC conjugated
1-CSB-PA005124LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDSN. Recognizes CDSN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CDSN Antibody, Biotin conjugated
1-CSB-PA005124LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDSN. Recognizes CDSN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CDSN Recombinant Protein (Mouse)
RP123242	ABM	100 ug	Ask for price

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

CDSN sgRNA CRISPR Lentivector set (Human)
K0423101	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Human CDSN(Corneodesmosin) ELISA Kit